Questions
Indicate each statement as No Evolution or Evolution Occurring (If Evolution is Occurring indicate by Selection...

Indicate each statement as No Evolution or Evolution Occurring (If Evolution is Occurring indicate by Selection or No Selection) with a brief explanation:

  1. 10 generations of selective breeding, and no change in the environment, produces dogs that bark less.
  2. Humans today are larger than our ancestors because we have access to better nutrition.
  3. Swimming ability is random with respect to genetics, and individuals that swim better survive the annual flood along the river. Over time, the population has more good swimmers.
  4. Individual plants have an allele for either red flowers or blue flowers. The deer grazing in your yard prefers to eat the red flowers and so the blue flowers survive and reproduce more.
  5. Digit length in Ay Ayes is heritable. After a strong bout of selection, you find that all Aye Ayes have the same length of digits
  6. A mutation conferring resistance to distemper occurs in racoons. Within 7 generations, you find that 50% of individuals in the population have the mutation

In: Biology

Can you describe one agonist and one antagonist for each of the neurotransmitters listed here, other...

Can you describe one agonist and one antagonist for each of the neurotransmitters listed here, other than the ones mentioned in the text? How do they affect NT activity?

  • acetylcholine
  • endorphins
  • norepinephrine
  • serotonin
  • GABA
  • glutamate

In: Biology

INTERACTION 1: Burdocks are a group of weeds and dispersal of their seeds is critical to...

INTERACTION 1: Burdocks are a group of weeds and dispersal of their seeds is critical to their life cycle. Their seeds have spines with hooks that allow them to be picked up by the fur of animals passing by. The spines do not hurt the animals they attach to.

INTERACTION 2: Wax moths live in the nests of honeybees. Their larvae eat the stored honey of the bees, as well as the larvae of workers and reproductive honeybees. The adults mate and disperse to lay eggs in new nests.

INTERACTION 3: Spider crabs live in shallow areas of the ocean floor, and greenish-brown algae lives on the crabs' backs, making the crabs blend in with their environment, and unnoticeable to predators. The algae gets a good place to live, and the crab gets camouflage.

Which of the above interactions is a mutualism?

Group of answer choices

Interaction 3

Interactions 1 & 2

Interaction 1

Interactions 1 & 3

Interaction 2

In: Biology

Carbohydrates are different than fats. Why do people who tend to eat a lot of carbohydrates...

Carbohydrates are different than fats. Why do people who tend to eat a lot of carbohydrates from soft drinks or sugary foods usually gain body fat?

nutrition

In: Biology

if a group that was thought to be monophyletic (morpholgy data) is show to be paraphyletic...

if a group that was thought to be monophyletic (morpholgy data) is show to be paraphyletic (DNA data) how would you try to resolve this issue?

In: Biology

A) What is the difference between a lytic cycle and a lysogenic cycle in bacteriophage biology...

A) What is the difference between a lytic cycle and a lysogenic cycle in bacteriophage biology (2pt)?

B) Can the same phage undergo both types of cycle and, if so, under what circumstances (2 pt)? Explain (with example).

In: Biology

The average molecular weight of a nucleotide (base + deoxyribose + 1 phosphate group) in DNA...

The average molecular weight of a nucleotide (base + deoxyribose + 1 phosphate group) in DNA is 308g/mol of 308 Daltons (Da). This number is the average molecular weight of
A = 312.2 g/mol
G = 328.2 g/mol
C = 288.2 g/mol T = 303.2 g/mol
55

R-plasmid was used for the transformation experiment

a.What is the size of this plasmid (in kilo base pairs; kbp)? How many bases is this?
b. What is the molecular weight of one plasmid molecule?
c. You used 25μl of 1ng/μl plasmid DNA per transformation. How many grams of plasmid DNA
did you use? How many moles of plasmid DNA is that? How many molecules of plasmid DNA
is that?
d. Assuming each transformed cell pick up one plasmid molecules during the transformation
process, what percentage of DNA molecules successfully entered and replicated inside the
competent cells?

In: Biology

Define 1- Obligate anaerobes 2- Obligate aerobes 3- Mesophilic 4- Thermophiles 5-Coenzyme 6-Chemoautotrophs 7-Ribozyme 8-Proton motive...

Define

1- Obligate anaerobes

2- Obligate aerobes

3- Mesophilic

4- Thermophiles

5-Coenzyme

6-Chemoautotrophs

7-Ribozyme

8-Proton motive force

In: Biology

1. White blood cells such as leukocytes, neutrophils, and monocytes can engulf large foreign substances like...

1. White blood cells such as leukocytes, neutrophils, and monocytes can engulf large foreign substances like bacteria.

During this process the plasma membrane of the white blood cell invaginates, forming a pocket around the bacteria cell. The pocket pinches off, resulting in the bacteria cell being contained in a newly created intracellular vesicle formed from the plasma membrane.

Which of the following processes could be responsible for white blood cells engulfing bacteria cells?

Exocytosis

Endocytosis

Pinocytosis

Osmosis

2. Water travels up to 124m from the roots to the top of Giant Sequoias. During this journey water travels against the force of gravity through narrow “circulatory” vessels inside of the tree. Which two water properties are responsible to such a feat?! Name AND briefly describe the properties.

Please use complete sentences to explain your answer.

3. You are helping your 13-year old cousin edit their biology lab report about protein structure and function. Then you encounter a sentence in the report that says “the high temperature broke down the protein into many pieces and this affected its ability to function”. How would you correct this misunderstanding?

In: Biology

1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...

1. The given mRNA sequence is transcribed from the gene below it.

5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’

3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’

5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’

Within the double-stranded DNA above:

a. Which strand ( top / bottom ) is the coding strand?

b. Circle the -10 promoter element.

c. Underline a single nucleotide indicating the transcription start site.

d. Circle the translation start and stop codons.

e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always some 5’ untranslated region encoded in the mRNA. Give the N and C ends of the protein.

In: Biology

How would you describe the complexity of the health industry in terms of workforce, environment, and...

How would you describe the complexity of the health industry in terms of workforce, environment, and social expectations? How would a health leader successfully navigate this complexity?

In: Biology

Explain the set-up and outcome of Griffith’s transformation experiment ? Describe the Ames test and how...

  1. Explain the set-up and outcome of Griffith’s transformation experiment ?
  2. Describe the Ames test and how it used to test the mutagenic properties of chemicals    I NEED ANSWERS FOR BOTH QUESTION , THAT IS , ALSO SEPARATE ANSWERS FOR BOTH QUESTIONS 1 AND 2 !!!!

In: Biology

1. Discuss how a pathogen causes an infection. Include definitions for primary pathogen, opportunistic pathogen, infection,...

1. Discuss how a pathogen causes an infection. Include definitions for primary pathogen, opportunistic pathogen, infection, disease (caused by a living organism), and various stages of pathogenesis. You can choose a specific organism to describe (like Orthomyxovirus and Influenza) or discuss a generalized infection.

2.

Describe each type of infection in the following list and include the mode of transmission in each scenario. Use terms such as primary, secondary, healthcare-associated, STI, mixed, latent, toxemia, chronic, zoonotic, asymptomatic, local, and systemic to describe the types of infections (more than one term may apply, some may not apply to these conditions)

1) The development of Pneumocystis pneumonia in an AIDS patient
2) Salmonellosis
3) Hantavirus pulmonary syndrome infection acquired while vacationing in a log cabin

In: Biology

a. You are conducting a lab experiment on the promoter regions of genes. In one experiment...

a. You are conducting a lab experiment on the promoter regions of genes. In one experiment you apply heat to two sections of DNA that you believe could be promoter regions. One region unwinds at 80 degrees C and the other unwinds at 60 degrees C. Which of the two strands contain the promoter? Explain.

b. Apply your knowledge of genetics to explain what would happen in a nucleus if histones were negatively charged.

In: Biology

1)Lets do a simple bayesian calculation. 60% of frogs are female, the rest male. All male...

1)Lets do a simple bayesian calculation.

60% of frogs are female, the rest male.

All male frogs sing, but only 10% of female frogs sing.

You hear a frog singing.

What is the posterior probability that this singing frog is male?

(hint! The probability of any frog singing is the probability  of a singing female (.6 x .1) plus that of a singing male (.4 x 1))

1)23%

2)35%

3)75%

4)87%

2)Which is the most complicated model for molecular sequence evolution?  

1)Jukes Cantor

2)F81

3)HKY

4)GTR

3)You run modeltest on your data and determine that you do not have equal frequencies of bases, but you don't see any evidence that transversions are any more or less common than translations. Which model should you use?

1)JC

2)F81

3)HKY

4)GTR

4)The support values on trees generated via bayesian methods convey:

1)How likely that clade is

2)What proportion of trees that are likely to come from the provided data contain the clade in question

3)How many substitions are found in the sequences between two taxa

4)The quality of the analysis

In: Biology