1. The given mRNA sequence is transcribed from the gene below it.
5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’
3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’
5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’
Within the double-stranded DNA above:
a. Which strand ( top / bottom ) is the coding strand?
b. Circle the -10 promoter element.
c. Underline a single nucleotide indicating the transcription start site.
d. Circle the translation start and stop codons.
e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always some 5’ untranslated region encoded in the mRNA. Give the N and C ends of the protein.
In: Biology
How would you describe the complexity of the health industry in terms of workforce, environment, and social expectations? How would a health leader successfully navigate this complexity?
In: Biology
In: Biology
1. Discuss how a pathogen causes an infection. Include definitions for primary pathogen, opportunistic pathogen, infection, disease (caused by a living organism), and various stages of pathogenesis. You can choose a specific organism to describe (like Orthomyxovirus and Influenza) or discuss a generalized infection.
2.
Describe each type of infection in the following list and include the mode of transmission in each scenario. Use terms such as primary, secondary, healthcare-associated, STI, mixed, latent, toxemia, chronic, zoonotic, asymptomatic, local, and systemic to describe the types of infections (more than one term may apply, some may not apply to these conditions)
1) The development of Pneumocystis pneumonia in an AIDS
patient
2) Salmonellosis
3) Hantavirus pulmonary syndrome infection acquired while
vacationing in a log cabin
In: Biology
a. You are conducting a lab experiment on the promoter regions of genes. In one experiment you apply heat to two sections of DNA that you believe could be promoter regions. One region unwinds at 80 degrees C and the other unwinds at 60 degrees C. Which of the two strands contain the promoter? Explain.
b. Apply your knowledge of genetics to explain what would happen in a nucleus if histones were negatively charged.
In: Biology
1)Lets do a simple bayesian calculation.
60% of frogs are female, the rest male.
All male frogs sing, but only 10% of female frogs sing.
You hear a frog singing.
What is the posterior probability that this singing frog is male?
(hint! The probability of any frog singing is the probability of a singing female (.6 x .1) plus that of a singing male (.4 x 1))
1)23%
2)35%
3)75%
4)87%
2)Which is the most complicated model for molecular sequence evolution?
1)Jukes Cantor
2)F81
3)HKY
4)GTR
3)You run modeltest on your data and determine that you do not have equal frequencies of bases, but you don't see any evidence that transversions are any more or less common than translations. Which model should you use?
1)JC
2)F81
3)HKY
4)GTR
4)The support values on trees generated via bayesian methods convey:
1)How likely that clade is
2)What proportion of trees that are likely to come from the provided data contain the clade in question
3)How many substitions are found in the sequences between two taxa
4)The quality of the analysis
In: Biology
Lab: Darwin’s Theory of Natural Selection in Action: Peppered Moth Simulation
Purpose:
To describe the importance of coloration in avoiding predation
To relate environmental change to changes in organisms
To explain how natural selection causes populations to change
Background:
Industrial melanism is a term used to describe that adaptation of a population in response to pollution. One example of rapid industrial melanism occurred in populations of peppered moths in the area of Manchester, England from 1845 to 1890. Before the industrial revolution, the trunks of the trees in the forest around Manchester were light grayish-green due to the presence of lichens. Most of the peppered moths in the area were light colored with dark spots. As the industrial revolution progressed, the tree trunks became covered with soot (chimney smoke) and turned dark. Over a period of 45 years, the dark variety of the peppered moth became more common.
Materials:
2 sheets of white paper
2 sheets of any colored paper
Tweezers
Scissors
Clock with a second hand
Hypothesis: (remember that a hypothesis is a testable statement)
If the color of the prey matches the background color than (complete the statement)______
____________________________________________________________________________.
Procedure:
Data Table:
|
Trial # |
Background |
Starting Population of white cutouts |
Starting population of colored cutouts |
Number remaining of white cutouts |
Number remaining of colored cutouts |
|
1 |
White |
20 |
20 |
||
|
2 |
White |
20 |
20 |
||
|
3 |
colored |
20 |
20 |
||
|
4 |
colored |
20 |
20 |
Analysis:
Conclusion:
Write a 5 sentence summary of a) what the experiment tested and showed b) how the experiment relates to natural selection c)how the experiment is an example of evolution (gradual change). Use the space below:
In: Biology
14.) Complete b oxidation of a 10:1Δ7 fatty acid yields which of the following?
15.) Complete b oxidation of an 11:1Δ7 fatty acid yields which of the following in addition to propionyl-CoA (3:0)?
A) 4 acetyl CoA + 3 FADH2 + 4 NADH + 4 H+ B) 4 acetyl CoA + 4 FADH2 + 4 NADH + 4 H+
C) 5 acetyl CoA + 3 FADH2 + 4 NADH + 4 H+ D) 5 acetyl CoA + 4 FADH2 + 5 NADH + 5 H+
E) 6 acetyl CoA + 5 FADH2 + 6 NADH + 6 H+ F) 6 acetyl CoA + 5 FADH2 + 5 NADH + 5 H+
G) 6 acetyl CoA + 4 FADH2 + 5 NADH + 5 H
In: Biology
The following reaction is a part of the TCA cycle:
succinate + FAD ⇄ fumarate + FADH2
3) The E°’ for the reduction of FAD is -0.22 V and the E°’ for the reduction of fumarate is 0.03 V. Calculate ΔE°’ for the full reaction given above. Show your work. Be mindful of units. (1 pt)
4) Use your answer from part (3) to calculate ΔG°’ for the full forward reaction given above. Use F = 96,500 J V-1 mol-1. Show your work. Be mindful of units. (1 pt)
5) The ΔG°’ for the forward reaction is positive, and yet we know the TCA cycle is able to proceed in the cell. Is this a contradiction of thermodynamic principles? In two to three sentences, briefly explain your reasoning. (2 pts)
6) Let’s look at the same reaction, but under a new set of conditions that more closely match intracellular concentrations: [FADH2] / [FAD] = 10 [succinate] = 1.7 mM [fumarate] = 100 µM Derive an equation to calculate ΔE from ΔE°’, n, R, T, F, and the concentrations provided above. n = number of electrons Use R = 8.314 J mol-1 K-1, T = 298 K, and F = 96,500 J V-1 mol -1. Simplify the equation as much as you can before calculating ΔE. Show your work. Be mindful of units. Only round at the very end and write your answer out to four decimal places. (2 pts)
I just need help on parts 5 and 6 please explain
In: Biology
1. Describe the function of the FeS04 in the KIA medium.
2. How many days does it take to complete the gelatin hydrolysis test.
3. How many hours minimum must you incubate the gelatin hydrolysis test?
4. Lysine Decarboxyclase test: Give two ways to prevent the diffusion of oxygen into the medium in this test.
5. Describe the Kirby Bauer Method.
6. Why must the CAMP test be performed on a blood agar plate?
In: Biology
Describe briefly the evolution of Craniata and Vertebrata.
In: Biology
Shown below is a list of molecules that function in fruit fly development and a list of distribution patterns. Match the molecules to their normal distribution in fruit fly embryos.
|
|
(Put each letter to each Answer)
Two-dimensional gel electrophoresis is used to characterize the physical characteristics and expression levels of:
| A. |
proteins |
|
| B. |
lipids |
|
| C. |
microtubules |
|
| D. |
DNA polymorphisms |
|
| E. |
mRNA |
The end product of a multistep process that includes 1) digestion of genomic DNA by restriction enzymes, 2) ligation of this DNA into vectors, 3) transformation of bacteria with the recombinant DNA molecules, and 4) isolation of individual bacterial clones that carry this recombinant DNA.
| A. |
Genomic library |
|
| B. |
CD library |
|
| C. |
cDNA library |
|
| D. |
Gene expression |
|
| E. |
RNA library |
Long stretches of uninterrupted codons in genomic DNA are known as:
| A. |
open reading frames |
|
| B. |
amino acids |
|
| C. |
stop codons |
|
| D. |
translocations |
|
| E. |
point mutations |
In: Biology
|
A. |
beads-on-a-string structure |
|
B. |
pyrimidine |
|
C. |
proof for the semi-conservative model of DNA replication |
|
D. |
number of base pairs per turn of the double helix |
|
E. |
biochemical evidence of complementarity |
|
F. |
number of nanometers between stacked bases |
|
G. |
positive supercoiling |
|
H. |
transduction |
|
I. |
percentage of adenine in a DNA molecule if the percentage of thymine is 18% |
|
J. |
direction of new strand synthesis |
|
K. |
involves two hydrogen bonds |
|
L. |
site of chemical difference between DNA and RNA |
|
M. |
negative supercoiling |
|
N. |
radioisotope for labeling DNA |
|
O. |
revealed by X-ray crystalography |
|
P. |
test for dynamic changes in chromatin structure |
|
Q. |
site of actively transcribed genes |
|
R. |
double-ring base |
|
S. |
'attacks' phosphate group of incoming dNTP |
|
T. |
direction of polymerase movement in terms of the template orientation |
|
U. |
B-form secondary structure |
|
V. |
radioisotope for labeling proteins |
|
W. |
involves three hydrogen bonds |
|
X. |
transformation |
|
Y. |
formed by loops on a protein scaffold |
|
Z. |
site of DNA's acidic property |
|
AA. |
Barr body |
|
AB. |
DNA monomer |
|
AC. |
substrate of DNA polymerase |
|
AD. |
formed by attractive interactions between chromatosomes |
|
AE. |
differential enzymatic digestion of cell lysate |
|
AF. |
differential radioisotope labeling of proteins and DNA |
|
AG. |
percentage of adenine in a DNA molecule if the percentage of guanine is 18% |
Choices-
|
phosphate group |
2'-OH group, deoxyribonucleoside triphosphate, deoxyribonucleotide, adenine, guanine, Chargaff's rules, Avery, McLeod, McCarty experiment, Hershey-Chase experiment, 5'-to-3', 3'-to-5', N-15, S-35, G-C complementarity, change in phenotype due to uptake of foreign DNA, 10, 32, 45 complete helical turns in a 600 bp DNA molecule ,
|
causes compaction of DNA and promotes strand separation |
, 30 nm fiber, 300 nm fiber, euchromatin, heterochromatin ,
|
DNase I sensitivity, cytosine |
In: Biology
Describe one beneficial and one harmful way in which microorganisms interact with agricultural crops
In: Biology
All the living things in one area combined with the non-living parts of that environment is a/an:
Question 15 options:
|
|||
|
|||
|
|||
|
In: Biology