What are the environmental conditions such as during the process of decellularizing and regenerating cells? And if I want find some resources about environment condition for decellularizing and regenerating, can you give some sources?

one environmental topic that is focused on preservation of the ecosystem, land management, sustainable resources, biomes, protection of our oceans, lakes, and rivers, or protection of endangered species ?

the subject is

B) Name and describe 3 theories of heredity that Gregor Mendel introduced to the world. Describe these 3 theories completely.

This is a microbial physiology question related to taxonomy, phylogeny, and physiology:

Can you describe and apply techniques such as: Southern, Western, hybridization, genetic probes, ELISA, TLC, among others?

Indicate each statement as No Evolution or Evolution Occurring (If Evolution is Occurring indicate by Selection or No Selection) with a brief explanation:

1. 10 generations of selective breeding, and no change in the environment, produces dogs that bark less.
2. Humans today are larger than our ancestors because we have access to better nutrition.
3. Swimming ability is random with respect to genetics, and individuals that swim better survive the annual flood along the river. Over time, the population has more good swimmers.
4. Individual plants have an allele for either red flowers or blue flowers. The deer grazing in your yard prefers to eat the red flowers and so the blue flowers survive and reproduce more.
5. Digit length in Ay Ayes is heritable. After a strong bout of selection, you find that all Aye Ayes have the same length of digits
6. A mutation conferring resistance to distemper occurs in racoons. Within 7 generations, you find that 50% of individuals in the population have the mutation

Can you describe one agonist and one antagonist for each of the neurotransmitters listed here, other than the ones mentioned in the text? How do they affect NT activity?

• acetylcholine
• endorphins
• norepinephrine
• serotonin
• GABA
• glutamate

INTERACTION 1: Burdocks are a group of weeds and dispersal of their seeds is critical to their life cycle. Their seeds have spines with hooks that allow them to be picked up by the fur of animals passing by. The spines do not hurt the animals they attach to.

INTERACTION 2: Wax moths live in the nests of honeybees. Their larvae eat the stored honey of the bees, as well as the larvae of workers and reproductive honeybees. The adults mate and disperse to lay eggs in new nests.

INTERACTION 3: Spider crabs live in shallow areas of the ocean floor, and greenish-brown algae lives on the crabs' backs, making the crabs blend in with their environment, and unnoticeable to predators. The algae gets a good place to live, and the crab gets camouflage.

Which of the above interactions is a mutualism?

Group of answer choices

Interaction 3

Interactions 1 & 2

Interaction 1

Interactions 1 & 3

Interaction 2

Carbohydrates are different than fats. Why do people who tend to eat a lot of carbohydrates from soft drinks or sugary foods usually gain body fat?

nutrition

A) What is the difference between a lytic cycle and a lysogenic cycle in bacteriophage biology (2pt)?

B) Can the same phage undergo both types of cycle and, if so, under what circumstances (2 pt)? Explain (with example).

The average molecular weight of a nucleotide (base + deoxyribose + 1 phosphate group) in DNA is 308g/mol of 308 Daltons (Da). This number is the average molecular weight of
A = 312.2 g/mol
G = 328.2 g/mol
C = 288.2 g/mol T = 303.2 g/mol
55

R-plasmid was used for the transformation experiment

a.What is the size of this plasmid (in kilo base pairs; kbp)? How many bases is this?
b. What is the molecular weight of one plasmid molecule?
c. You used 25μl of 1ng/μl plasmid DNA per transformation. How many grams of plasmid DNA
did you use? How many moles of plasmid DNA is that? How many molecules of plasmid DNA
is that?
d. Assuming each transformed cell pick up one plasmid molecules during the transformation
process, what percentage of DNA molecules successfully entered and replicated inside the
competent cells?

Define

1- Obligate anaerobes

2- Obligate aerobes

3- Mesophilic

4- Thermophiles

5-Coenzyme

6-Chemoautotrophs

7-Ribozyme

8-Proton motive force

1. White blood cells such as leukocytes, neutrophils, and monocytes can engulf large foreign substances like bacteria.

During this process the plasma membrane of the white blood cell invaginates, forming a pocket around the bacteria cell. The pocket pinches off, resulting in the bacteria cell being contained in a newly created intracellular vesicle formed from the plasma membrane.

Which of the following processes could be responsible for white blood cells engulfing bacteria cells?

2. Water travels up to 124m from the roots to the top of Giant Sequoias. During this journey water travels against the force of gravity through narrow “circulatory” vessels inside of the tree. Which two water properties are responsible to such a feat?! Name AND briefly describe the properties.

Please use complete sentences to explain your answer.

3. You are helping your 13-year old cousin edit their biology lab report about protein structure and function. Then you encounter a sentence in the report that says “the high temperature broke down the protein into many pieces and this affected its ability to function”. How would you correct this misunderstanding?

1. The given mRNA sequence is transcribed from the gene below it.

5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’

3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’

5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’

Within the double-stranded DNA above:

a. Which strand ( top / bottom ) is the coding strand?

b. Circle the -10 promoter element.

c. Underline a single nucleotide indicating the transcription start site.

d. Circle the translation start and stop codons.

e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always some 5’ untranslated region encoded in the mRNA. Give the N and C ends of the protein.