Question 1: William Comanor and Thomas Wilson1 specified the following regression in their study of advertising’s...

Question 1: William Comanor and Thomas Wilson1 specified the following regression in their study of advertising’s effect on the profit rates of 41 consumer goods firms: PRi = β0 + β1 ×ADVi/SALESi + β2 ×lnCAPi + β3 ×lnESi + β4 ×lnDGi + i where: PRi = the profit margin of the ith firm ADVi = the advertising expenditures in the ith firm (in dollars) SALESi = the total gross sales of the ith firm (in dollars) CAPi = the capital needed to enter the ith firm’s market at an efficient size ESi = the degree to which economies of scale exist in the ith firm’s industry DGi = percent growth in sales (demand) of the ith firm over the last 10 years a) Hypothesize expected signs for each of the slope coefficients. b) Note that there are two different kinds of nonlinear (in the variables) relationships in this equation. For each independent variable, determine the shape that the chosen functional form implies, and state whether you agree or disagree with this shape. Explain your reasoning in each case. c) Comanor and Wilson state that the simple correlation coefficient between ADVi/SALESi and each of the other independent variables is positive. If one of these other variables were omitted, in which direction would ˆ β1 likely be biased? Refer to your hypothesized signs of the coefficients in part (a).

In: Math

  The heart and circulatory system in vertebrates has changed significantly compared to the two-chambered heart of...

  The heart and circulatory system in vertebrates has changed significantly compared to the two-chambered heart of our fish ancestors. Describe the major changes in the general structure of the vertebrate heart starting with fish to amphibians to mammals and birds. Be sure to explain the evolutionary significance of these changes. For example, explain how changes in the heart have allowed mammals to grow large and both birds and mammals to be more active.

In: Biology

Geary Machine Shop is considering a four-year project to improve its production efficiency. Buying a new...

Geary Machine Shop is considering a four-year project to improve its production efficiency. Buying a new machine press for $720,000 is estimated to result in $240,000 in annual pretax cost savings. The press falls in the MACRS five-year class (MACRS Table), and it will have a salvage value at the end of the project of $105,000. The press also requires an initial investment in spare parts inventory of $30,000, along with an additional $4,500 in inventory for each succeeding year of the project. Required : If the shop's tax rate is 35 percent and its discount rate is 16 percent, what is the NPV for this project? (Do not round your intermediate calculations.) rev: 09_18_2012 $-106,139.92 $-103,318.84 $-170,365.41 $-111,446.91 $-100,832.92

In: Finance

How do I convert 29.35 W to J/sec? How do I convert 312 ft3s-1mi-2 to m3...

How do I convert 29.35 W to J/sec?

How do I convert 312 ft3s-1mi-2 to m3 min.-1km-2?

How do I convert from 2.2 km/hr to ft sec-1 and mi2 hr-1?

How do I convert from 5.4 ft sec-1 to cm sec-1 and m hr-1?

In: Physics

Matlab: When I plot "figure (3)", I would like it to produce three lines/curves instead of...

Matlab: When I plot "figure (3)", I would like it to produce three lines/curves instead of data points. Currently, the code will only produce a plot when I use characters and symbols. Please help...

%-------------------------------------------------------------------------------------------------------------%

clear all

close all

clc

xmax=1;

ne=100;

nx=ne+1;

dx=xmax/ne;

dxdx=dx+dx;

dx2=dx*dx;

dt=0.02;

%-------------------------------------------------------------------------------------------------------------%

for i=1:nx

u(i)=0;

bvec(i)=0;

end

u=u';

bvec=bvec';

amat(1,1)=1;

for i=2:nx-1

amat(i,i)=(2/dx2)+(1/dt);

amat(i,i-1)=-(1/dx2);

amat(i,i+1)=-(1/dx2);

end

amat(nx,nx)=1;

av=inv(amat);

for it=1:100

zt(it)=(it-1)*dt;

bvec(1)=-exp(-(zt(it)-0.5)^2/0.03);

for j=2:nx-1

bvect(j)=(u(j)/dt)+(1/2*u(j));

end

bvec(nx)=zt(it)*(sin(4*zt(it)))^4;

u=av*bvec;

for j=1:nx

out(it,j)=u(j);

end

end

%-------------------------------------------------------------------------------------------------------------%

figure(1)

mesh(out)

xlabel('X')

ylabel('Time')

zlabel('Temperature')

title('Temperature as a Function of Time and Space')

%-------------------------------------------------------------------------------------------------------------%

figure(2)

pcolor(out)

xlabel('X')

ylabel('Time')

title('Temperature as a Function of Time and Space')

%-------------------------------------------------------------------------------------------------------------%

figure(3)

for k=1:ne

plot(zt(k),out(k,1),'r*')

hold on

plot(zt(k),out(k,31),'b*')

hold on

plot(zt(k),out(k,61),'g*')

hold on

end

title('Time History of Temperature at Different Locations')

xlabel('Time')

ylabel('Temperature')

legend('x=0.0','x=0.3','x=0.6')

In: Computer Science

1.) An old vial of radioactivee material was found buried in the ground at Hanford Site....

1.) An old vial of radioactivee material was found buried in the ground at Hanford Site. in 2014, it was found to contain 0.1578 Ci of 238Pu and 0.1125 Ci of 234U. the vial was labebled year 1951. how many atoms of 238 Pu and 234U were present in the vial in 1951 ?

238 94U a (t1/2)=87.72 y -> 23492U a (t1/2)=2.455*10^5 y ->23090TTh

In: Chemistry

C++ program, include comments stating what each part of code does please. I want to be...

C++ program, include comments stating what each part of code does please. I want to be able to understand it so I'll be more knowledgeable in the future. The program is multiple files(transcribe_dna_to_rna.h file, transcribe_dna_to_rna.cpp file, main.cpp file and loops_strings_test.cpp). After the directions I also included any starter code or comments left by my professor within the files to aide us.

Directions:

In folder 05_loops_strings write prototype and definition for string value - return function transcribe_dna_into_rna with a string parameter that returns the rna string. Write the required unit test(s) in folder 05_loops_strings_test. Main program flow: No loop. Use the given string as function argument call transcribe_dna_into_rna function and display the output.

transcribe_dna_to_rna.h

/*
Create a function transcribe_dna_into_rna with a dna const reference string parameter that returns a string.
*/

transcribe_dna_to_rna.cpp

//Write include statements
/*
An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'.
Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing
all occurrences of 'T' in t with 'U' in u.
Given: A DNA string
Return: The transcribed RNA string of the DNA string
Examle:
dna_string: GATGGAACTTGACTACGTAAATT
transcribe_dna_into_rna("GATGGAACTTGACTACGTAAATT");
returns:
GAUGGAACUUGACUACGUAAAUU
*/

main.cpp

//Write include statements
//Write using statements
/*
No loop.
Use the string "GATGGAACTTGACTACGTAAATT" call the transcribe_dna_into_rna function and display the result
*/
int main()
{
return 0;
}

loops_strings_test.cpp

#define CATCH_CONFIG_MAIN // This tells Catch to provide a main() - only do this in one cpp file
#include "catch.hpp"
//Write include statements
/*
Write test case for transcribe dna to rna with string:
"GATGGAACTTGACTACGTAAATT" returns GAUGGAACUUGACUACGUAAAUU
*/

In: Computer Science

data information NAME: Hat measurements, including hat size TYPE: Observational SIZE: 26 observations, 6 variables DESCRIPTIVE...

data information

NAME:  Hat measurements, including hat size
TYPE:  Observational
SIZE:  26 observations, 6 variables

DESCRIPTIVE ABSTRACT:
 
The dataset contains hat size as well as circumference, length of major axis 
and length of minor axis of the inner hat band for 26 hats. The manufacturer 
and the country of manufacture are also included.

SOURCE:

Katherine Brady and Kari Cornelius, Carleton College ('96) students, gathered 
the observations from hats at a store at the Mall of America in Bloomington, 
Minnesota.

VARIABLE DESCRIPTIONS:

Variables 
1         Hat size
2         Circumference (inches)
3         Length of major axis (inches)
4         Length of minor axis (inches)
5         Where made? Italy = 1, U.S.A. = 2
6         Manufacturer? Beaver = 1, Borsalino = 2, Dobbs = 3, Stetson = 4

please answer the follow question

How many variables are there, and how are they defifined?

Which variables are quantitative and which are categorical?

What are the units of measurement for each quantitative variable?

What questions do you plan to investigate in your project? These may be questions that were of interest

to the researchers who collected data, or they may be questions that you thought of yourself. Make sure to

include questions that you can hope to answer using methods from this course.

In: Math

The expected pretax return on three stocks is divided between dividends and capital gains in the...

The expected pretax return on three stocks is divided between dividends and capital gains in the following way:

Stock

Expected Dividend

Expected Capital Gain

A

$0

$10

B

5

5

c

10

0

a. If each stock is priced at $190, what are the expected net percentage returns on each stock to (i) a pension fund that does not pay taxes, (ii) a corporation paying tax at 21% (the effective tax rate on dividends received by corporations is 6.3%), and (iii) an individual with an effective tax rate of 15% on dividends and 10% on capital gains?

b. Suppose that investors pay 50% tax on dividends and 20% tax on capital gains. If stocks are priced to yield an after-tax return of 8%, what would A, B, and C each sell for? Assume the expected dividend is a level perpetuity.

If each stock is priced at $190, what are the expected net percentage returns on each stock to (i) a pension fund that does not pay taxes, (ii) a corporation paying tax at 21% (the effective tax rate on dividends received by corporations is 6.3%), and (iii) an individual with an effective tax rate of 15% on dividends and 10% on capital gains? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places.)

Stock

Pension

Investor Corporation

Individual

A

%

%

%

B

%

%

%

C

%

%

%

Suppose that investors pay 50% tax on dividends and 20% tax on capital gains. If stocks are priced to yield an after-tax return of 8%, what would A, B, and C each sell for? Assume the expected dividend is a level perpetuity. (Do not round intermediate calculations. Round your answers to 2 decimal places.)

Stock

Price

A

$

B

$

C

$

In: Finance

Importance of Accounting and international business Write a 250 words post explaining why having an international...

Importance of Accounting and international business

Write a 250 words post explaining why having an international accounting overview is important. Provide examples.

In: Accounting

The following costs result from the production and sale of 4,550 drum sets manufactured by Tight...

The following costs result from the production and sale of 4,550 drum sets manufactured by Tight Drums Company for the year ended December 31, 2019. The drum sets sell for $305 each. The company has a 40% income tax rate.

Variable production costs
Plastic for casing $ 127,400
Wages of assembly workers 423,150
Drum stands 168,350
Variable selling costs
Sales commissions 118,300
Fixed manufacturing costs
Taxes on factory 9,500
Factory maintenance 19,000
Factory machinery depreciation 79,000
Fixed selling and administrative costs
Lease of equipment for sales staff 19,000
Accounting staff salaries 69,000
Administrative management salaries 149,000



Required:

1. Prepare a contribution margin income statement for the year.
2. Compute its contribution margin per unit and its contribution margin ratio.
3. For each dollar of sales, how much is left to cover fixed costs and contribute to operating income?

In: Accounting

If ?H = -60.0kJ and ?S = -0.300kJ/K , the reaction is spontaneous below a certain...

If ?H = -60.0kJ and ?S = -0.300kJ/K , the reaction is spontaneous below a certain temperature. Calculate that temperature.

In: Chemistry

Consider this scenario: You own a small business with 25 employees. In your initial post, explain...

Consider this scenario: You own a small business with 25 employees. In your initial post, explain which internal controls you would use to protect your assets and ensure that your financial statements are accurate.

In: Accounting

What sort of records should be kept according the Taxation Administration Act 2005?   How long must...

What sort of records should be kept according the Taxation Administration Act 2005?   How long must these records be kept for? ( Approximate Word Count 20)

In: Accounting

At a certain temperature, this reaction establishes an equilibrium with the given equilibrium constant, Kc. 3A(g)+2B(g)−⇀↽−4C(g)Kc=2.53×1031...

At a certain temperature, this reaction establishes an equilibrium with the given equilibrium constant, Kc.

3A(g)+2B(g)−⇀↽−4C(g)Kc=2.53×1031

If, at this temperature, 1.70 mol of A and 3.50 mol of B are placed in a 1.00 L container, what are the concentrations of A, B, and C at equilibrium?

[A]=

[B]=

[C]=

In: Chemistry