Questions
A common clinical manifestation of pulmonary infections is pulmonary edema. Explain what leads to the accumulation...

A common clinical manifestation of pulmonary infections is pulmonary edema. Explain what leads to the accumulation of fluid in the alveolar spaces and explain how pulmonary edema impairs lung function.

In: Biology

Does phosphorylation of a signaling protein by an upstream kinase represent a signaling input or output?...

Does phosphorylation of a signaling protein by an upstream kinase represent a signaling input or output? Explain.

In: Biology

describe the variation that exists among protists with respect to their cell surface, motility, nutrition and...

describe the variation that exists among protists with respect to their cell surface, motility, nutrition and cellular organization

In: Biology

Which type of epitope(s) are recognized by the B cell receptor? a. Linear epitopes. b. Conformational...

Which type of epitope(s) are recognized by the B cell receptor?

a. Linear epitopes.

b. Conformational epitopes.

c. Embedded epitopes.

d. Both a and b.

In: Biology

The Omo remains and mitochondrial DNA analysis suggest that the earliest humans first evolved approximately:

The Omo remains and mitochondrial DNA analysis suggest that the earliest humans first evolved approximately:

In: Biology

Discuss in detail (not just enumerate) at least three factors that contribute to the current worldwide...

Discuss in detail (not just enumerate) at least three factors that contribute to the current worldwide expansion of vector-transmitted diseases.

Explain in some detail (not just enumerate) at least FOUR factors that contribute to healthcare-associated infections and four strategies to reduce their incidence.

In: Biology

Define and explain the terms genotype and phenotype. Give an example of a genotype and phenotype;...

Define and explain the terms genotype and phenotype. Give an example of a genotype and phenotype; indicate how the genotype and phenotype are related. Define and explain what an allele is. Give an example of an allele and indicate how alleles are related to a genotype.

In: Biology

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

In: Biology

explain how the Hershey-Chase experiment conclusively proved that DNA and not protein was the genetic material?

explain how the Hershey-Chase experiment conclusively proved that DNA and not protein was the genetic material?

In: Biology

You test two different bacterial strains with the nitrate test. One tube (organism 1) turns red...

You test two different bacterial strains with the nitrate test. One tube (organism 1) turns red after the addition of reagents A and B, while organism 2 stays colorless. You wait two minutes and add zinc to organism 2, after which it turns red. Are organisms 1 and 2 both positive for the nitrate test? Explain.

In: Biology

When we consume carbohydrate, it gets digested and absorbed as glucose. It is then stored in...

When we consume carbohydrate, it gets digested and absorbed as glucose. It is then stored in the liver and muscle as _______________________. When we consume insufficient energy, our body draws on stored glycogen and breaks it down into _______________ to be used as energy.
What parts of the body require glucose as an energy substrate?
1. .
2. .
3. .
When glycogen stores are fully depleted, the body needs to derive energy from other substrates. Protein in the body is broken down into amino acids. What are these converted into to provide energy for the brain? _______________________________________________
What other two compounds are produced as a result of this process?
1. .
2. .
If we consume protein in excess of our needs, it is stored as ________________________. The waste product of this reaction is ______________________________.
Fat consumed in excess of our needs is stored in adipose tissue. When energy consumed is inadequate and glycogen stores are depleted, our stored fat is broken down into fatty acids. What else is formed when these are used to form glucose for the brain? _________________________

What happens to our metabolic rate as a consequence of prolonged fasting ? __________

identify at least three environmental influences on our food consumption:
1. .
2. .
3. .
identify which macronutrients best promote satiation and satiety.
Satiation:
Satiety:
list the four main components of energy expenditure:
1. .
2. .
3. .
4. .
We also looked at factors that influence the basal metabolic rate. What is the most significant predictor of basal metabolic rate? ________________________________________

In: Biology

1. How do osmotic power plants work? 2 Research the structures that protect plant and animal...

1. How do osmotic power plants work?

2 Research the structures that protect plant and animal cells from damage resulting from osmotic pressure. Write a few paragraphs explaining what they are, how they work, and where they are located.

In: Biology

Compare the following (with definitions and phylogenetic trees): monophyletic, paraphyletic, and polyphyletic taxonomic groups.

Compare the following (with definitions and phylogenetic trees): monophyletic, paraphyletic, and polyphyletic taxonomic groups.

In: Biology

Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA...

Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator?

A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA

B. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCAAAAAAATTATA

C. TGAAAAACATCGCATTTTAACGAAACGCGCTGCATTTATTTTTTTT

D. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCATTTATTTTTTTT

In: Biology

As a macronutrient, proteins are unique in that they contain which atom ? ____________ There are...

As a macronutrient, proteins are unique in that they contain which atom ? ____________
There are 20 common amino acids. How many of these are essential amino acids? ______________________
Amino acids are joined together by peptide bonds. What reaction takes place to join amino acids together ? ______________________________
Number of amino acids complete the following table.
Peptide

Dipeptide
Tripeptide
Polypeptide
Provide a definition for deamination?

Provide a definition for transamination?

Excess nitrogen needs to be excreted from our bodies. In the form of ammonia, nitrogen is toxic, so our body combines ammonia with carbon dioxide to make urea which can be excreted through the kidneys. What impact does this have on our fluid requirements?

The instructions for making a protein are the __________________________
The template for the instructions is the _______________________________
The amino acid carrier is the ________________________
_____________________ ensures that amino acids are placed in the correct positions
The amino acids are bonded together by the _________________________________

list eight functions of protein:
1. .
2. .
3. .
4. .
5. .
6. .
7. .
8. .

list three examples of food containing high quality protein:
1. .
2. .
3. .
What high quality protein foods would be suitable for consumption by a vegan? ________________


Can you think of two or more foods that you could combine to provide all of the essential amino acids?
1. .
2. .

In: Biology

Subjects