Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA...

Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator?

A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA

B. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCAAAAAAATTATA

C. TGAAAAACATCGCATTTTAACGAAACGCGCTGCATTTATTTTTTTT

D. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCATTTATTTTTTTT

Solutions

Expert Solution

Answer :- C and D.

Explanation :- In the termination of transcription there are two available way i.e rho-dependent or and rho-independent termination or intrinsic termination.

In rho-dependent termination required a hexamar protein called rho factor , when RNA polymerase attached to this rho factor the polymerization process terminate.

In rho-independent or intrinsic termination doesn't required any protein factor. In the region of DNA inverted repeat are there when newly synthesize RNA come to this inverted repeat form hairpin like structure and polymerization process terminated i.e DNA template separated from RNA. This intrinsic termination characterized by the presence of Guanine-Cytocine rich inverted repeat region followed by a series of consecutive thymidylate which provide signal to RNA polymerase to stop the polymerization.

So from the above discussion we found the sequence of option C and D have G-C rich region followed by a stretch of thymidylate region , which indicate the presence of intrinsic termination site.

So from the above discussion we can conclude that the answer is option C and D.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

1. The presence of protein in the urine indicates which of the following? Select one: A....

1. The presence of protein in the urine indicates which of the following? Select one: A. damage to the renal tubules B. damage to the filtration membrane C. too much protein in the diet D. high levels of transcription and translation by the bodies tissues Question 2 Adipose tissue is one of the most hydrated of all tissues in the human body. Select one: True False Question 3 The path urine takes after it is formed until it leaves the...

Which of the following are arithmetic sequences, which are geometric sequences, and which are neither? (a)...

Which of the following are arithmetic sequences, which are geometric sequences, and which are neither? (a) 5, 10, 20, 40, 80, Describe the sequence and the change in it. (b) 3, 8, 13, 18, 23, 28, Describe the sequence and the change in it. (c) 1, 4, 9, 16, 25 Describe the sequence and the change in it.

Which of the following is not a characteristic of transcriptional activator proteins?

Which of the following is not a characteristic of transcriptional activator proteins? They can interact with other components of the transcriptional apparatus. They are capable of binding DNA at a consensus sequence in the protein-coding part of the gene. They contain one or more DNA-binding motifs. They are capable of binding DNA at a consensus sequence of a regulatory promoter. They can influence the rate of transcription.

Which of the following is/are signal(s) for termination of transcription in prokaryotes? I. The rho factor...

Which of the following is/are signal(s) for termination of transcription in prokaryotes? I. The rho factor II. Stem and loop RNA structures and a poly uracil sequence III. The sigma factor IV. Transcription factor TFIID I and II only I, II and III only I, II, III, and IV I, II, and IV only

1.) Which of the following are elements involved in eukaryotic transcriptional regulation? a.) All of the...

1.) Which of the following are elements involved in eukaryotic transcriptional regulation? a.) All of the choices are correct b.) promoters c.)enhancers d.)silencers e.)transcriptional elements 2.) The tryptophan operon is repressible opeon that is a.) turned off whenever tryptophan is added to the growth medium. b.)turned on only when tryptophan is present in the growth medium. c.) permanently turned on. d.) turned on only when glucose is present in the growth medium

Consider the following set of dependent and independent variables. Using? technology, check for the presence of...

Consider the following set of dependent and independent variables. Using? technology, check for the presence of multicollinearity. If multicollinearity is? present, take the necessary steps to eliminate it. y x1 x2 x3 10 2 15 5 10 5 10 15 16 5 13 9 13 8 10 12 22 7 2 18 23 11 8 17 27 16 7 23 30 20 4 20 26 39 8 27 38 22 5 30 A. Eliminate the variable (x ?) which has...

genes are made of which of the following types of sequences that code for one or...

genes are made of which of the following types of sequences that code for one or more proteins

1. a. Consider the following sequences, which are pieces of a larger, independently folding polypeptide. Which...

1. a. Consider the following sequences, which are pieces of a larger, independently folding polypeptide. Which sequence is more likely to form an alpha helix, and which is more likely to form a beta-hairpin—a two-stranded antiparallel beta-sheet in which the strands are separated by a turn? Sequence A: I F I C T T G P N A T V I C V F V Sequence B: M D R L M E A M A K L D H...

11.Which of the following sequences of amino acids is the most likely to be located on...

11.Which of the following sequences of amino acids is the most likely to be located on the exterior of a water soluble globular protein? a. Arg-Ser-Gln-Pro-His b. Met-Phe-Ile-Leu-Ala c. Val-Leu-Ser-Ala-Val d. Met-Val-Cys-Leu-Gln QUESTION 12 1. Which pair of amino acid side chains might form a London dispersion force type of van der Waals interaction in a globular protein? a. His and Ser b. Ala and Gln c. His and Met d. Val and Met QUESTION 13 1. The β-hairpin consists...

The steps to creating an information security plan would be in which of the following sequences?...

The steps to creating an information security plan would be in which of the following sequences? Identify threats, identify risks, design controls, incorporate controls into an enterprise-wide plan, Set forth policies Set forth policy, design controls, identify risks, identify threats, incorporate controls into an enterprise-wide plan

Subjects