If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

Expert Solution

Ans.

There are four nitrogen base that a DNA nucleotides can contain.They are Adenine (A),thymine (T),guanine (G) and cytosine (C). When these nucleotides form a long chain by coming together, they are known as a DNA strand. It is the hydrogen bonds that forms between these bases that holds two strands of DNA together. In general, Adenine bonds with thymine whereas cytosine bonds with guanine.A can pair with either T or C but do not pair with G.

Now, In genetics the term complementary refers to the double strands where one polynucleotide strand that is paired with the reverse complement of the other strand.

According to Chargaff's rule of complementary base-paring, Adenine (A) only bonds with Thymine (T) and Cytosine (C) only bonds with Guanine (G) in a strand of DNA. This is because adenine and guanine are purines whereas thymine and guanine are pyrimidines.Two purines if bond together will take a lot of space between the strands,which will make the bond weaker and thus won't allow the strands to be held together.Same is the case for thymine and guanine both of which are pyrimidines, but instead of too much space,they will take too little space thus making the bond unstable. Apart from this, the hydrogen bonding between the bases A & T and C & G is what actually holds the DNA strands.

Hence by the above rule, for the DNA strand ATTGCTCG, following will be its complementary strand:

TAACGAGC

gladiator answered 1 year ago

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

learn how to find the nucleotide sequence of the complementary DNA STRAND

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

If one strand of the DNA has the sequence of AGCTTC what will be the other...

If one strand of the DNA has the sequence of AGCTTC what will be the other strand be ? A DNA nucleotide consists of Small extrachromosoal pieces of DNA found in prokaryotes which replicate independently of the of the chromosome and provide the cell with different traits are Codons are recognized during The role of translation is to

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes. How many DNA fragments will you get? D) You choose to cut...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

Question