please provide information about Gnetophyta in your own words at least 50
including
physical characteristics ,reproduction ,Relationship with Humans, Fun Facts
In: Biology
In: Biology
In: Biology
Explain the function of the sarcoplasmic reticulum and T tubules in skeletal muscle contraction.
In: Biology
In: Biology
In: Biology
In: Biology
Summary:
Answer the following questions in detail. You have three hours to complete the final exam.
Question 1:
Student life is full of stressors. Give three sources of stress and explain how they affect students’ academic performance.
Question 2:
Time management is one way colege students can use to reduce stress. Give three time management techniques and explain how they can halp students manage their time better and improve their academic performance.
In: Biology
· A strain of yeast requiring both tyrosine (tyr-) and arginine (arg-) is crossed to the wild type. After meiosis, the following 10 asci are dissected. Classify each ascus as to the segregational type (PD, NPD, TT). What is the linkage relationship between these two loci?
1 arg-tyr- arg+tyr+ arg+tyr+ arg-tyr-
2 arg+tyr+ arg+try+ arg-tyr- arg-tyr-
3 arg-tyr+ arg-tyr+ arg+tyr- arg+tyr-
4 arg-tyr- arg-tyr- arg+tyr+ arg+tyr+
5 arg-tyr- arg-tyr+ arg+tyr- arg+tyr+
6 arg+tyr+ arg+tyr+ arg-tyr- arg-tyr-
7 arg-tyr- arg+tyr+ arg-tyr+ arg+tyr-
8 arg+tyr+ arg+tyr+ arg-tyr- arg-tyr-
9 arg+tyr+ arg-tyr- arg-tyr- arg+tyr+
10 arg-tyr- arg+tyr+ arg+tyr+ arg-tyr-
In: Biology
Regarding an epidemiological outbreak ,discuss the four major routes by which pathogens spread.Also, discuss methods that one would introduce to stop the spreading of pathogens
In: Biology
1) Given your understanding of transcription and translation, fill in the items below with the proper sequences. Please align your answers under the nontemplate DNA strand. Ignore RNA stop codons if they are present.
Nontemplate strand of DNA: 5′- A T G T A T G C C A A T G C A -3′
Template strand of DNA:
RNA:
Anticodons on tRNA:
Amino acid sequence:
2) Original template strand of DNA: 3′- T A C G C A A G C A A T A C C G A C G A A -5′
a. Transcribe this sequence:
RNA:
b. Translate the RNA sequence. Ignore start/stop codons if present.
Amino acid sequence:
3) The table below lists five single-base point mutations that may occur in DNA. What happens to the amino acid sequence as a result of each mutation? (Position 1 refers to the first base at the 3′ end of the DNA strand. Position 21 would refer to the last base at the 5’ end.). Note that amino acids are numbered from L à R as 1-7.
Original template strand: 3’ TACGCAAGCAATACCGACGAA 5’
RNA strand:
Amino acid sequence: (number aa’s 1-7 L-R)
|
Mutation |
Effect on amino acid sequence. Write ~3 amino acids around the mutation site to show a tripeptide sequence with the change. Indicate the aa numbers of the new tripeptide. |
|
i. Substitution of T for G at position 8. |
|
|
ii. Addition of T between positions 8 and 9. |
|
|
iii. Deletion of C at position 15. |
|
|
iv. Substitution of T for C at position 18. |
|
|
v. Deletion of C at position 18. |
|
|
vi. Which of the mutations above produces the greatest change in the amino acid sequence of the polypeptide coded for by this 21-base-pair gene? That is, which will have the largest effect on structure? Why is this? |
|
In: Biology
Describe the structure and function of each of the
following blood cells
Basophil,Eosinophil, Neutrophil,Monocytes,Macrophage and Dentritic
cells
In: Biology
PARASITOLOGY QUESTION:
Amoeba case study
Calatagan is a third-class municipality in the province of Batangas, Philippines. It has a total population of 30,500 with a total of 8 barangays. The municipality’s major revenue comes from agriculture and aquaculture. A section of the population is employed in “Ang Pulo,” an island housing a mangrove forest conservation park located in the northeast. Some residents of Calatagan are settled along the major highway that connects it to neighboring municipalities, while some live further inland, usually near farms. Major streets are cemented but small streets are not. Deep well is the main source of water but there is one water distillery station serving three barangays in the municipality. In the summer of 2005, there were 950 cases of a rare eye infection in one barangay that affected residents of different ages. The infection is characterized by severe pain and reddening of the cornea. Antiviral drugs where administered but the patients’ condition did not improve. There were also 1500 reported cases of diarrhea by the RHU. Stool examination results from specimens submitted by patients revealed an increase in WBC count. Strange crystal-like structures were also seen under the microscope in some of the stool specimens. The mayor of Calatagan ordered an immediate investigation of the probable cause of the cases.
Questions to answer:
1. Identify the probable cause of the incidents in Calatagan, Batangas. Justify. (provide references for your answers)
2. What could have been the sources of infection of the residents in Calatagan? Describe the probable mode of infection for each identified cause. Cite examples and references.
3. Briefly provide a possible plan of action on how to control the cases in Calatagan.
In: Biology
Describe the physiological and anatomical characteristics that confer drought tolerance on plants. Which of the following is more suitable for Australia's climate? explain your answer
In: Biology
Which plant group or subgroup is the most prominent in each ecozone and how does this relate to the features of each ecozone?
In: Biology