The frequency of the sickle cell allele is high in populations at low elevations in East Africa, where mosquitos breed year-round, and lower in high elevation populations where mosquitos are much less abundant. Which, if any, evolutionary processes might contribute to these differences in allele frequencies? Explain your answer.
In: Biology
For each of the scenarios below:
a) state why evolution is occurring
b) state whether mutation, natural selection, genetic drift or gene flow appears to be the mechanism of evolution
c) and describe why you picked a particular mechanism of evolution
Scenario 1: Researchers have been studying an isolated, small population of wolves (fewer than 30 individuals) on Isle Royale in Lake Superior for the past 30 years. This year they find that there are only 16 individuals left in the population and only 1 of these individuals is a female.
Scenario 2: A large population of colonially nesting (large groups of individuals nest together in a colony) shorebirds varies in plumage color from very white to dark gray. During the breeding season, a train derailment causes a toxic substance to flow into a lake where the colony is located. Approximately 75% of the mating individuals in the colony die. During the following breeding season, researchers notice that almost all of the individuals in the population have medium to dark gray plumage.
In: Biology
a) Explain what factors, structures, and ion channels contribute to establishing and maintaining the resting membrane potential. Draw a cell and show all relevant contributors to the resting membrane potential with explanations of how they contribute to establish and maintain the resting membrane potential.
b) What cells have a resting membrane potential? Is it only nerve and muscle (excitable) cells?
In: Biology
Describe the role of the hypothalamus and pituitary gland in controlling metabolic rate. .
In: Biology
1. How do enzymes benefit chemical reactions within living
organisms? What are some examples of enzymes? Provide at least 3
examples of specific enzymes found within living things.
2. What molecules store energy within living organisms? Provide at
least 2 examples.
3. Why is water so important within living organisms? What are some
of the functions of water within living organisms?
4. What is an element that is known to be toxic to living
organisms? Be sure to name the element, give its symbol, and at
least one harmful effect it has on a living organism.
In: Biology
membrane transport refers to the mechanisms by which solutes cross the pasma membrane, but there are additional prockaryotype cell structures through which a solute would pass when entering or exiting a cell,. Sequence the path of a solute from.....
In: Biology
what are the affinities of H. floresiensis to Homo habilis?
In: Biology
1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.
A) agarose gel
B) sample mixture
C) positively charged electrode
D) negatively charged electrode
2. The restriction enzyme SacI has a recognition sequence of
GAGCT^C, where the caret (^) indicates the cut site. Examine the
DNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you
treated the above DNA molecule with SacI?
A) four
B) three
C) five
D) two
3. The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?
A) four
B) three
C) five
D) two
In: Biology
Read the following examples that use the above terms: A farmer wanted to test the effects of different amounts of fertilizer on tomatoes. He decided to measure the weight of the tomatoes from the plants (yield), since selling his tomatoes generates income. He applies different amounts of fertilizer (the independent variable) to different batches of his plants, and then determines the yield (the dependent variable) of the different batches to decide what amount of fertilizer works best. He includes some unfertilized plants for his control. The yield is dependent on the amount of fertilizer. The amount of fertilizer is independent because the farmer can decide how much he will use. Practice Part A: SCENARIO 1: A microbiologist working for a pharmaceutical company has isolated a chemical from a newly discovered strain of a fungus. He has done some preliminary tests and thinks that the chemical might kill the bacteria that cause gonorrhea. He prepares some bacterial growth medium (aka “agar”) and adds the new chemical to one batch, and leaves one without the antibiotic. He then adds the same amount of the bacteria that cause gonorrhea to each container of growth media and incubates them.
The microbiologist’s hypothesis was that if____________________________________, then ___________________________________________________________________. In this experiment, the antibiotic is the ________________________________________ Whether or not the bacteria can grow in the presence of the antibiotic is the ___________ ________________________________________________________________________ The growth media without the antibiotic is the __________________________________ Why was the same amount of bacteria added to both containers of growth media? _______________________________________________________________________ SCENARIO 2: Phyllis has just purchased a home in Florida. She is very excited about growing plumeria trees in her yard. She wants the trees to produce as many flowers as possible so she decides to test if different amounts of water to see if that has an effect on the number of flowers. Her sprinkler system automatically releases a set amount of water (gallons per minute) so the only way for her to adjust the water amount is to shorten/ lengthen the amount of time the plants get watered. Tree #1 gets watered every day for 2 hours. Tree #2 gets watered every other day for 2 hours. Tree #3 gets watered twice a day for 2 hours each interval. What is the independent variable of this experiment? ________________________________________________________________________ What is the dependent variable of this experiment? ________________________________________________________________________ What is a constant of this experiment? ________________________________________________________________________ What is another constant of this experiment? ________________________________________________________________________
In: Biology
1 pound = ________ kilograms
1 inch = _______ centimeters
1 mile = ___ Kilometers
1 quart = _______ liters
How many liters in a gallon: ___________________
How many quarts, exactly, are in a 3 liter bottle of Coke: __________________
Convert 35 centimeters to inches: _____________________
How many yards are in 1,000 meters: ____________________
How long in meters is the 440 yard dash: ____________________
How many centimeters are in an inch: _____________________
How many grams are in 10 ounces: _____________________
How many kilograms are in 75 pounds: _____________________
How many milliliters are in a liter: ________________
How many millimeters in a kilometer: ____________
How many microliters in a liter: ______________
A millimeter is what fraction of a meter: _______________
A micrometer is what fraction of a millimeter: _______________
A milligram is what fraction of a kilogram: ________________
How many microliters are in a milliliter: _____________
How many meters are in a kilometer: _________________
How many micrometers are in a meter: ________________
A micrometer is what fraction of a meter: __________________
In: Biology
compare protein transport to ER with protein transport from ER to Golgi. what is the diffrence between the two methods?
In: Biology
Design a flow cytometry experiment (Step by step) to test the effect of fish oil on neutral killing cells. Explain in details (Add references if needed)
In: Biology
Please be as discriptive as possible. (Break it down dummy style please) Regarding the posted article “Hepatitis E vaccine debuts: Success of Chinese biotech partnership raises hopes for prevention of overlooked diseases” (Nature 10/29/2012): The workers made a recombinant subunit vaccine in E. coli host cells. Hepatitis E virus is a non-enveloped virus that contains an RNA genome and icosahedral capsid. Describe a stepwise process that could be used to develop and produce the vaccine. You have purified hepatitis E virus genomic RNA as starting material. (side question: if it’s recombinant would cloning be involved why or why not?)
In: Biology
Describe an experiment to compare the stiffness effects of cell vs. extracellular matrix on stem cell using hydrogels.
In: Biology
1. What factors limit the size of cells? Be sure to list at
least two factors.
2. How do cells communicate with other cells? Be sure to detail at
least one specific example in detail.
3. What are some examples of prokaryotic cells? What are some
examples of eukaryotic cells?
4. In what specific ways to antibiotics affect bacteria?
In: Biology