One likely reason that only microbes existed for the first two billion years of life is

a) high concentrations of ozone in the stratosphere.

b) the absence of nitrogen in the environment at the time.

c) the toxicity of oxygen to multicellular organisms.

d) high levels of iron oxide in the water.

e) low concentrations of O2 at that time.

. Imagine you are studying a new cooperative breeding vertebrate species and you find that groups of females can be either related or unrelated. What would you predict in terms of group size (larger or smaller) and reproductive skew (more or less) in these different types of groups. Explain your reasoning.

Please make an article about implementation of good manufacturing practice in food industry. Must be 500-700 words

a) What is the role of studies of other organisms in understanding the organization and development of the nervous system?

b) What is the advantage for a species of developmental, individual variation?

1. Some bacteria can stop the activation of complement. Suggest 2 things bacteria might do to complement proteins to stop or prevent complement activation. Describe how stopping complement activation would protect the bacteria.

What is the role of plasticity in development of the individual? How can two individuals with identical genotypes exhibit different phenotypes?

In eurkaryote transcription, what is an exon and interon, and what is 5 capping and poly A tailing?

What are different mechanisms through which genetic variation occurs? Describe the mechanism in detail in which a specialized plasmid plays a role for genetic variation to occur.

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.

a) Underline the promoter region of this gene by a dotted line.

b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?

c) Deduce the nucleotide sequence of mRNA for this gene.

d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino

acids does this mRNA code for? What is the sequence of the codons in this mRNA?

e) Show 5’ and 3’ ends of the template strand and mRNA.

f) What are the -10 and +10 base pairs of this gene?

CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

6. The final step in the infectious process is disease production (or pathology). By what major mechanism can an infection with microorganisms result in disease? Give an example of each mechanism for the pathogens.

A 68 year old women was admitted to a hospital because of headaches that began a month earlier. She was in good health, prior to developing severe headaches, vertigo, photophobia, lethargy, and forgetfulness. Her temperature was 98.9 degrees F, and she knew her name but not the date. She had some resistance to bending her neck, consistent with mild inflammation of the meninges. She also had past-pointing when reaching for objects. A lumbar puncture revealed a total white blood cell count of 18/microliter ( normal is up to 4) and 75% polymorphonuclear leukocytes. CSF glucose was low suggesting a microbe was present in the subarachnoid space. The lab tech performing the wbc count noticed cells that were not wbc. To investigate further, the tech centrifuged the CSF, and stained the sediment with India ink. The round cell appeared to be budding, much like yeasts. In addition, the cell appeared to have a capsule.

1. What type of microbe could be causing the meningitis? Give one reason to support your answer based on the information provided.

2. Of the following eukaryotic microbes, which one is characterized by having polysaccharide capsules? Candida albicans, Histoplasma capsulatum, Crytococcus neoformans.

In July of 2003 a construction worker came to a hospital in Palm Beach County complaining of fever, headaches, chills, nausea and malaise. After being treated for dehydration he was discharged. Two days later he returned to the hospital with worsening symptoms, and was admitted with a diagnosis of malaria. The next day his blood smear revealed Plasmodium. During July and August a plumber who worked outside, a fisherman who fished in the evenings, a golfer, a homeless individual, a carpenter and an outdoorsman all had Plasmodium infections. Six of the seven men had never traveled to a malarious region, none had had recent blood transfusions or was an IV drug user. Targeted mosquito trapping produced no Plasmodium-infected mosquitoes.

3. What could an epidemiologist infer from the interviews of the seven patients? What disease did all seven have?

4. How is this disease transmitted? How was it transmitted in this case?

Describe how chromosome rearrangements may be produce by breakage or crossing over between repetitive DNA sequences

1. Find one new fossil discovery, how it did/did not change what is already known for species related to the discovery and how it relates to Darwin’s theory of evolution

2. DNA evidence of changes to the evolutionary tree that is currently accepted

3. Find one new human DNA or fossil or anthropological discovery and explain how it relates to Darwin’s theory of evolution

4. Choose a new method of artificial selection for crops or animals (pets or livestock usually) and explain its connection with Darwin’s theory of evolution.

Full research about the biological human signals (ECG, EMG, EEG) time domain and frequency domain analysis (showing all the calculations, diagrams, graphs, wave signals, simulation or a design, Matlab wave, or signal) basically anything related to this topic. (1000 words)