Questions
please provide information about Gnetophyta in your own words at least 50 including physical characteristics ,reproduction...

please provide information about Gnetophyta in your own words at least 50

including

physical characteristics ,reproduction ,Relationship with Humans, Fun Facts



In: Biology

Essay Question: Disscuss the structure of chloroplasts. Explain why this structure is required to achieve the...

Essay Question: Disscuss the structure of chloroplasts. Explain why this structure is required to achieve the function of chloroplasts. Please be descriptive.

In: Biology

Over exploitation for food and commercial use are some of the key challenges to conservation in...

Over exploitation for food and commercial use are some of the key challenges to conservation in Ghana
True /false

Spanish fly is an insect whose chemical substance is used as an aphrodisiac.
True / False

Insects have a narrower range of foods than human.
True / false

The compound eye is the only eye found in insects.
True / false

The Endo-skeleton in insects provides them with a strong physical protection
True / false

Creating favorable non-hostile habitats is one of the way of controlling insects
True / false

Some insects are known to be carriers or vectors of diseases
True /false

Insects are the most numerous of all living things on mars
True / False

The insect dye , cochineal is to give brown sugar it’s color
True / false

The fashion industry got its first design from the wings of butterflies
True / false

Insects poisons or venoms are always bad
True / false

The navigational abilities of insects can be likened to the modern day GPS device
True / false

There are adult insects that do not feed on solid food
True / false

John the Baptiste survived on insect meal all his life
True / false

Organic insecticides are man-made or synthetic
True/ false

Contact insecticides are sprayed onto insects and work directly on insects cuticle.
True / false

Smokeless coils can kill mosquitoes and are therefore not safe to sleep with them burning
True / false

Dancing in bees is used for communication
True / false

The spider is one of the most common household insects
True / false

Millipedes and centipedes are two groups of insects found in farms
True / false

Insects are known to have six pairs of legs
True / false

In: Biology

Explain the function of the sarcoplasmic reticulum and T tubules in skeletal muscle contraction.

Explain the function of the sarcoplasmic reticulum and T tubules in skeletal muscle contraction.

In: Biology

Question 6 (0.5 point) How many stages are used in describing the pathways of catabolism? •...



Question 6 (0.5 point) How many stages are used in describing the pathways of catabolism?

• 1

• 2

• 3

• 4



Question 7 (0.5 point) Most of the energy generated during the breakdown of biomolecules [from your food] is produced during Stage .

• 1

• 2

• 3

• 4



Question 8 (0.5 point) What are the names of the two parts of Stage 4?

• Citric Acid Cycle and Electron Transport

• Electron Transport and Oxidative Phosphorylation

• Oxidative Phosphorylation and Glycolysis

• Glycolysis and the Krebs Cycle



Question 9 (0.5 point) Oxygen is required during Stage 4.

• True

• False



Question 10 (0.5 point) The energy generated during metabolism is released in ______ portions as the result of _______ reactions.

• small; many

• small; a few

• large; many

• large; a few

In: Biology

Essay Question: Discuss the moleculear interactions in the active site that allow the substrate to bind...

Essay Question: Discuss the moleculear interactions in the active site that allow the substrate to bind to the enzyme. Please be descriptive.

In: Biology

Essay Question: Describe the allosteric regulation of phosphfructokinase during glycolysis. Please be very descriptive.

Essay Question: Describe the allosteric regulation of phosphfructokinase during glycolysis. Please be very descriptive.

In: Biology

Summary: Answer the following questions in detail. You have three hours to complete the final exam....

Summary:

Answer the following questions in detail. You have three hours to complete the final exam.

Question 1:

Student life is full of stressors. Give three sources of stress and explain how they affect students’ academic performance.

Question 2:

Time management is one way colege students can use to reduce stress. Give three time management techniques and explain how they can halp students manage their time better and improve their academic performance.

In: Biology

·     A strain of yeast requiring both tyrosine (tyr-) and arginine (arg-) is crossed to the...

·     A strain of yeast requiring both tyrosine (tyr-) and arginine (arg-) is crossed to the wild type. After meiosis, the following 10 asci are dissected. Classify each ascus as to the segregational type (PD, NPD, TT). What is the linkage relationship between these two loci?

1             arg-tyr-                arg+tyr+               arg+tyr+               arg-tyr-

2             arg+tyr+               arg+try+               arg-tyr-                arg-tyr-

3             arg-tyr+               arg-tyr+               arg+tyr-               arg+tyr-

4             arg-tyr-                arg-tyr-                arg+tyr+               arg+tyr+

5             arg-tyr-                arg-tyr+               arg+tyr-               arg+tyr+

6             arg+tyr+               arg+tyr+               arg-tyr-                arg-tyr-

7             arg-tyr-                arg+tyr+               arg-tyr+               arg+tyr-

8             arg+tyr+               arg+tyr+               arg-tyr-                arg-tyr-

9             arg+tyr+               arg-tyr-                arg-tyr-                arg+tyr+

10           arg-tyr-                arg+tyr+               arg+tyr+               arg-tyr-

In: Biology

Regarding an epidemiological outbreak ,discuss the four major routes by which pathogens spread.Also, discuss methods that...

Regarding an epidemiological outbreak ,discuss the four major routes by which pathogens spread.Also, discuss methods that one would introduce to stop the spreading of pathogens

In: Biology

1) Given your understanding of transcription and translation, fill in the items below with the proper...

1) Given your understanding of transcription and translation, fill in the items below with the proper sequences. Please align your answers under the nontemplate DNA strand. Ignore RNA stop codons if they are present.

Nontemplate strand of DNA:                 5′- A T G T A T G C C A A T G C A -3′

     Template strand of DNA:       

                                 RNA:       

             Anticodons on tRNA:      

            Amino acid sequence:

2) Original template strand of DNA:  3′- T A C G C A A G C A A T A C C G A C G A A -5′

a. Transcribe this sequence:

                                      RNA:

b. Translate the RNA sequence. Ignore start/stop codons if present.

                 Amino acid sequence:

3) The table below lists five single-base point mutations that may occur in DNA. What happens to the amino acid sequence as a result of each mutation? (Position 1 refers to the first base at the 3′ end of the DNA strand. Position 21 would refer to the last base at the 5’ end.). Note that amino acids are numbered from L à R as 1-7.

Original template strand:  3’ TACGCAAGCAATACCGACGAA 5’

                   RNA strand:

     Amino acid sequence:                                                            (number aa’s 1-7 L-R)

Mutation

Effect on amino acid sequence. Write ~3 amino acids around the mutation site to show a tripeptide sequence with the change. Indicate the aa numbers of the new tripeptide.

i. Substitution of T for G at position 8.

ii. Addition of T between positions 8 and 9.

iii. Deletion of C at position 15.

iv. Substitution of T for C at position 18.

v. Deletion of C at position 18.

vi.   Which of the mutations above produces the greatest change in the amino acid sequence of the polypeptide coded for by this 21-base-pair gene? That is, which will have the largest effect on structure? Why is this?

In: Biology

Describe the structure and function of each of the following blood cells Basophil,Eosinophil, Neutrophil,Monocytes,Macrophage and Dentritic...

Describe the structure and function of each of the following blood cells
Basophil,Eosinophil, Neutrophil,Monocytes,Macrophage and Dentritic cells

In: Biology

PARASITOLOGY QUESTION: Amoeba case study Calatagan is a third-class municipality in the province of Batangas, Philippines....

PARASITOLOGY QUESTION:

Amoeba case study

Calatagan is a third-class municipality in the province of Batangas, Philippines. It has a total population of 30,500 with a total of 8 barangays. The municipality’s major revenue comes from agriculture and aquaculture. A section of the population is employed in “Ang Pulo,” an island housing a mangrove forest conservation park located in the northeast. Some residents of Calatagan are settled along the major highway that connects it to neighboring municipalities, while some live further inland, usually near farms. Major streets are cemented but small streets are not. Deep well is the main source of water but there is one water distillery station serving three barangays in the municipality. In the summer of 2005, there were 950 cases of a rare eye infection in one barangay that affected residents of different ages. The infection is characterized by severe pain and reddening of the cornea. Antiviral drugs where administered but the patients’ condition did not improve. There were also 1500 reported cases of diarrhea by the RHU. Stool examination results from specimens submitted by patients revealed an increase in WBC count. Strange crystal-like structures were also seen under the microscope in some of the stool specimens. The mayor of Calatagan ordered an immediate investigation of the probable cause of the cases.

Questions to answer:

1. Identify the probable cause of the incidents in Calatagan, Batangas. Justify. (provide references for your answers)

2. What could have been the sources of infection of the residents in Calatagan? Describe the probable mode of infection for each identified cause. Cite examples and references.

3. Briefly provide a possible plan of action on how to control the cases in Calatagan.

In: Biology

Describe the physiological and anatomical characteristics that confer drought tolerance on plants. Which of the following...

Describe the physiological and anatomical characteristics that confer drought tolerance on plants. Which of the following is more suitable for Australia's climate? explain your answer

In: Biology

Which plant group or subgroup is the most prominent in each ecozone and how does this...

Which plant group or subgroup is the most prominent in each ecozone and how does this relate to the features of each ecozone?

In: Biology