1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated...

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.

a) Underline the promoter region of this gene by a dotted line.

b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?

c) Deduce the nucleotide sequence of mRNA for this gene.

d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino

acids does this mRNA code for? What is the sequence of the codons in this mRNA?

e) Show 5’ and 3’ ends of the template strand and mRNA.

f) What are the -10 and +10 base pairs of this gene?

CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

Solutions

Expert Solution

a) CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

b) CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

Pribnow box ( -10 box ) is a consensus sequence of six nucleotide present in promoter region in a template strand of DNA , and is essential for transcription. It is recognized and bound by a subunit of RNA polymerase during initiation of transcription.

c) 5' GGGAGGCAGCGAUAUUACUUCAGCCUCUGCCUACAUGGCGCCUAUU 3'

d) 5' GGGAGGCAGCGAUAUUACUUCAGCCUCUGCCUACAUGGCGCCUAUU 3'

5' UTR ( upstream sequence of the atart codon) is known as the leader sequence.

underlined sequence are leader sequence and bold and underlined codon is the start codon.

this mRNA codes for 4 amino acid.

sequence of codons- MET Ala Pro Ile

e) 3' CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA 5' ----Template strand

5' GGGAGGCAGCGAUAUUACUUCAGCCUCUGCCUACAUGGCGCCUAUU 3' --- mRNA strand

f) CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

-10 +1 +10

gladiator answered 1 year ago

Next > < Previous

Related Solutions

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends...

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' My answers: Template= 5'- TAT CGA GCA TCG AAG CTA GCC TAG CT-3' RNA Molecule= 3'- AUA GCU CGU UGC UUC GAU CGG AUC GA-5' Next it asks, how many amino acids would the RNA molecule code for? -...

direction template strand is read in direction mRNA is synthesized in non-template DNA strand that corresponds...

direction template strand is read in direction mRNA is synthesized in non-template DNA strand that corresponds to mRNA codons except DNA code template DNA strand that corresponds to tRNA except in DNA code enzyme responsible for catalyzing transcription transcription initiation site in DNA proteins which aid in the binding of RNA polymerase type of pre-mRNA modification non-coding sequence in mRNA protein coding sequence in mRNA primary cellular component responsible for translation protein which binds to A site in ribosome to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

1) Comparing the wild-type and mutated template DNA strand, what kind of mutation is present?: 1)...

1) Comparing the wild-type and mutated template DNA strand, what kind of mutation is present?: 1) Wild-type template DNA: 3’ -T A C T G A C T G A C G -5’ Mutated template DNA: 3’ -T A C T G A C T A A C G -5’ What kind of mutation is present below? A) Missense B) Nonsense C) silent D) Frameshift 2) How do B cell and T cell receptors differ? A. TCRs are only able...

Related to translation: Predict the amino acid sequence for the given template strand of DNA. ...

Related to translation: Predict the amino acid sequence for the given template strand of DNA. 3’- T A C G T T C A T A T C C G T A T G T A T A T T – 5’

The following sequence represents the DNA template strand of a gene. 3′-TAC TGT GTC TCC CAC...

The following sequence represents the DNA template strand of a gene. 3′-TAC TGT GTC TCC CAC CGA ACT-5′ nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #7, what is the amino acid sequence? d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e. If there is a transversion at nucleotide #6, what...

Define the following terms (a) leading strand (b) lagging strand (c) template strand (d) coding strand

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence? If you have an RNA transcript that is 100 bp, how many codons does it contain? If you take the template DNA that is shown in question 1 and you mutate the 6thnucleotide from A to G how does that impact the polypeptide sequence Is it better to have a mutation...

Subjects