Answer all the questions.

Short answer:

Is there a difference between Body cavities and body systems, Explain?

Name the 5 cavities, and the organs that are contained within each cavity?

What are the organ functions?

What are the 2 different surgeries to remove gallbladder? Explain why you would have one over the other (include citations).

planes of the body: identify what organs are on each plane.

1. Dolly the sheep was a sheep that was born to an unrelated mom. Her genome was inserted into an egg that had the DNA removed. This is an example of

a. RNA sequencing b. cloning c. Genetic engineering d. RNA interference 10 points

QUESTION 7 1. What is "gene expression"?

a. DNA that is known to contain genes that can be expressed b. the movement of genes from one cell to the other c. the production of mRNA and proteins that occurs when a gene is transcribed at certain times in the life of the cell d. the production of mRNA and proteins that occurs when a gene is transcribed at certain times in the life of the cell

homozygous recessive is crossed with a heterozygote, what percent chance is there of getting a heterozygous genotype in f1?

1. How much time should be allowed to elapse once a kosher meat product has been consumed, before the consumption of a Kosher-dairy product is to be consumed?

2. Convert the basic ingredients used to produce ‘pastry cream’ into an authentic ‘vegan’ version.

1. Give five steps to making a dual resistant bacteria containing genes for resistance to ampicllin and Kanamycin

1.

2.

3.

4.

5.

2. State three importatn components of a vector

1.  Successful reproduction requires the precise coordination multiple, diverse processes in time and space. Similar to other species, these diverse processes are often regulated by a single factor.

A. Describe the multiple purposes and processes LH are involved in within the reproductive tract that permits the successful meeting of sperm and newly ovulated oocyte though the time the sperm is in proximity to the cumulus oophorus.

B. Describe the when, where and how of the multiple critical processes calcium induces or is involved in (i) within the reproductive tract and (ii) after the sperm attaches to the oocyte and (iii) after it enters the cytoplasm.

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Questions: (Just need the answer to #3)

1. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the items listed above. This means explaining how all aspects of the cell (inside and outside) may be impacted by these problems. The chain reaction of the system inside the cell. Some of them may be related and some of them might not, ultimately whether you can show the relationships demonstrates to me your understanding of the complexity and system of the cell.

a. Make sure to fully explain all of the items listed in the cellular dysfunction as well as all other related items in the system of a cell.

2. Identify and explain any causes that you believe may be associated with these cellular problems in one cell.

3. Explain how your team might be able to fix the one cell with these problems using cell biology and bioscience applications, such as Gene Therapy, developing new organelles, mitochondrial therapy, etc.

44. Which media/tests can be used to exhibit gas production?

1. Citrate
2. PRG
3. TSI
4. A and B
5. B and C

What are two main types of changes that have occurred in the evolution of primate teeth from the primitive mammalian pattern?

Explain why teeth are so important in evolutionary and functional studies

what are two important ways to classify tooth form

what are five limiting factors that would control the population density of weeds?

briefly describe the events in translation

How are Cdks activated? Be sure to include in your answer the roles of:
a) Cyclin
b) CAK

A nonscientist friend of yours asks how findings in a wormorfly can be relevant to human biology. Explain to your friend the importance of model organisms in molecular biology research.

1. Compare and contast one-dimensional SDS-PAGE and two-dimensional gel electrophoresis of proteins.

2. You have purified a protein. When you subject it to SDS-PAGE, two bands are seen. Provide a possible explanation and describe how you could test your hypothesis.

3. Compare and contrast the steps in production of polyclonal and monoclonal antibodies.

4. A chromatographic column in which oligo-dT is linked to an inert substance is useful in separating eukaryotic mRNA from other RNA molecules. On what principle does this column operate?

5. You plan to use the polymerase chain reaction to amplify part of the DNA sequence shown below, using oligonucleotide primers that are hexamers matching the regions shown in red. (In practice, hexamers are too short for most purposes). State the sequence of the primer oligonucleotides that should be used, including their polarity (5?3?), and give the sequence of the DNA molecule that results from amplification.

5?-TAGGCATGCAATGGTAATTTTTCAGGAACCAGGGCCCTTAAGCCGTAGGCAT-3? 3?-ATCGGTACGTTACCATTAAAAACTCCTTGGTCCCGGGAATTCGGCATCGGTA-5?

6. Complete the incomplete diagrams below to show the key structural difference between an NTP, dNTP, and ddNTP (e.g., CTP, dCTP, ddCTP).

What do “d” and “dd” stand for?

Explain why ddNTPs are called "chain terminators" in DNA sequencing reactions.