Question

In: Biology

Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decreased pH in mitochondria...

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Questions: (Just need the answer to #3)

1. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the items listed above. This means explaining how all aspects of the cell (inside and outside) may be impacted by these problems. The chain reaction of the system inside the cell. Some of them may be related and some of them might not, ultimately whether you can show the relationships demonstrates to me your understanding of the complexity and system of the cell.

a. Make sure to fully explain all of the items listed in the cellular dysfunction as well as all other related items in the system of a cell.

2. Identify and explain any causes that you believe may be associated with these cellular problems in one cell.

3. Explain how your team might be able to fix the one cell with these problems using cell biology and bioscience applications, such as Gene Therapy, developing new organelles, mitochondrial therapy, etc.

Solutions

Expert Solution

3.

  • The cell here shows that there is decrease in pH in cytosol and mitochondria.
  • This shows that the H+ ions are increased in the cytosol and mitochondria.
  • The H+ ion concentration is not maintained properly by the pumps.
  • Increase in ATP shows that , more ATP is needed by the cell. The more ATP production is done by using the reserved stores of glycogen and triglycerides.
  • The more ATP produced is thus utilised for cell proliferation and differentiation.
  • That is why there is high activity of mitogen activated protein kinases.
  • So, all these dydfunction arise due to mutated portion of the gene.
  • This can be corrected by using mitochondrial replacement therapy or gene therapy .
  • In mitochondrial replacement therapy, the whole mitochondria with defective gene is replaced.
  • But in gene therapy , the mitochondrial defective gene is replaced by normal gene . Here the whole mitochondria is not replaced but only the defective gen is replaced.
  • Thus , a cell can fix the dysfunction.

Related Solutions

The PH is within the normal range and CO2 and HCO3- are moving in the same...
The PH is within the normal range and CO2 and HCO3- are moving in the same direction, how would you classify this blood gas?
1. During cellular respiration, where is NADH produced? a) nucleus b) cytosol and mitochondrial matrix c)...
1. During cellular respiration, where is NADH produced? a) nucleus b) cytosol and mitochondrial matrix c) cytosol d) mitochondrial intermembrane space e) endoplasmic reticulum 2. The condensation of what two compounds in the citric acid cycle results in citrate? a) Pyruvate and Oxaloacetate b) Oxaloacetate and Acetyl (from Acetyl-CoA) c) Oxaloacetate and a phosphate d) Acetyl (from Acetyl-CoA) and CO2 e) None of the above 3. At the end of glycolysis which products are produced? a) 1 PYRUVATE, 4 ATP,...
4. Examine Table 1 below. Fill-in the normal range of values for each of the variables...
4. Examine Table 1 below. Fill-in the normal range of values for each of the variables in the last (blank) row. Table 1. Lab values for Joyce Snyder. (Serum) Time Point BP Temp. (°F) Hemat. (%) Glucose (mg/dL) Na+ (mEq/L) K+ (mEq/L) AChE Activity (% of normal) Thyroxine (pmol/L) Serum Triiodothyronine (FT3) (pg/dL) Antibodies for Ach Receptors 1 105/65 99.4 °F 37.5% 88 mg/dL 139 mEq/L 3.8 mEq/L 44% 9.1 pmol/L 112 pg/dL none 2 108/70 100.1 °F 38.0% 100...
1. Distinguish between reverse phase and normal phase separations. 2. What is the dynamic range for...
1. Distinguish between reverse phase and normal phase separations. 2. What is the dynamic range for absorbance spectroscopy? What is the dynamic range for fluorescence spectroscopy? Which has the lowest LOD and why? 3. What types of molecules fluoresce? What is quenching and what makes a good quencher? 4. What is the underlying equation for all partition chromatography methods? Why?
1. What is Cellular Respiration? 2. What are the reactants of cellular respiration?
 1. What is Cellular Respiration? 2. What are the reactants of cellular respiration? 3. What are the products of cellular respiration? 4. Define: a. Calorie b. Cellular respiration e. Aerobic d. Anaerobic e. Fermentation 5. Contrast aerobic and anaerobic respiration. 6. What are the three stages of cellular respiration? Where do they occur? 7. What is fermentation? 8. Compare and Contrast alcoholic fermentation and Lactic Acid Fermentation.
Answer the questions below 1)What are normal vital signs for an elderly client? 2)What are normal...
Answer the questions below 1)What are normal vital signs for an elderly client? 2)What are normal heart sounds? 3)Where do you listen for heart sounds? 4)Where would you listen for an apical heart rate and why would you listen for an apical heart rate? 5)What nursing interventions may be used to correct fever in the elderly client? 6)What can a client have while on a 2-gram sodium, low-cholesterol diet? Develop a meal plan: breakfast, lunch, and dinner with snacks and...
1. What is menopause? Perimenopause? 2. What is erectile dysfunction (ED)? a. List a medication used...
1. What is menopause? Perimenopause? 2. What is erectile dysfunction (ED)? a. List a medication used in the treatment of ED. b. Discuss a nursing implication of the medication. c. Discuss a teaching point of the medication. 3. What causes sexual problems? Name 3 issues. 4. Does sexual drive increase with age? Explain.
1. What is menopause? Perimenopause? 2. What is erectile dysfunction (ED)? a. List a medication used...
1. What is menopause? Perimenopause? 2. What is erectile dysfunction (ED)? a. List a medication used in the treatment of ED. b. Discuss a nursing implication of the medication. c. Discuss a teaching point of the medication. 3. What causes sexual problems? Name 3 issues. 4. Does sexual drive increase with age? Explain.
1. How is sexual dysfunction defined in the DSM-5? 2. How is sexual dissatisfaction defined and...
1. How is sexual dysfunction defined in the DSM-5? 2. How is sexual dissatisfaction defined and how is it different from sexual dysfunction? 3. What are the factors that are associated with sexual dysfunctionand and how they might contribute to sexual dysfunction?
1) Is the compliance decreased or increased on the above problem? 2) What is the naturally...
1) Is the compliance decreased or increased on the above problem? 2) What is the naturally occurring substance that helps keep the alveoli from collapsing? 3) Name the diseases where surfactant may be inactivated in adults?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT