Question

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Questions: (Just need the answer to #3)

1. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the items listed above. This means explaining how all aspects of the cell (inside and outside) may be impacted by these problems. The chain reaction of the system inside the cell. Some of them may be related and some of them might not, ultimately whether you can show the relationships demonstrates to me your understanding of the complexity and system of the cell.

a. Make sure to fully explain all of the items listed in the cellular dysfunction as well as all other related items in the system of a cell.

2. Identify and explain any causes that you believe may be associated with these cellular problems in one cell.

3. Explain how your team might be able to fix the one cell with these problems using cell biology and bioscience applications, such as Gene Therapy, developing new organelles, mitochondrial therapy, etc.

Answer 1

3.

• The cell here shows that there is decrease in pH in cytosol and mitochondria.
• This shows that the H+ ions are increased in the cytosol and mitochondria.
• The H+ ion concentration is not maintained properly by the pumps.
• Increase in ATP shows that , more ATP is needed by the cell. The more ATP production is done by using the reserved stores of glycogen and triglycerides.
• The more ATP produced is thus utilised for cell proliferation and differentiation.
• That is why there is high activity of mitogen activated protein kinases.
• So, all these dydfunction arise due to mutated portion of the gene.
• This can be corrected by using mitochondrial replacement therapy or gene therapy .
• In mitochondrial replacement therapy, the whole mitochondria with defective gene is replaced.
• But in gene therapy , the mitochondrial defective gene is replaced by normal gene . Here the whole mitochondria is not replaced but only the defective gen is replaced.
• Thus , a cell can fix the dysfunction.