Questions
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

In: Biology

explain how the Hershey-Chase experiment conclusively proved that DNA and not protein was the genetic material?

explain how the Hershey-Chase experiment conclusively proved that DNA and not protein was the genetic material?

In: Biology

You test two different bacterial strains with the nitrate test. One tube (organism 1) turns red...

You test two different bacterial strains with the nitrate test. One tube (organism 1) turns red after the addition of reagents A and B, while organism 2 stays colorless. You wait two minutes and add zinc to organism 2, after which it turns red. Are organisms 1 and 2 both positive for the nitrate test? Explain.

In: Biology

When we consume carbohydrate, it gets digested and absorbed as glucose. It is then stored in...

When we consume carbohydrate, it gets digested and absorbed as glucose. It is then stored in the liver and muscle as _______________________. When we consume insufficient energy, our body draws on stored glycogen and breaks it down into _______________ to be used as energy.
What parts of the body require glucose as an energy substrate?
1. .
2. .
3. .
When glycogen stores are fully depleted, the body needs to derive energy from other substrates. Protein in the body is broken down into amino acids. What are these converted into to provide energy for the brain? _______________________________________________
What other two compounds are produced as a result of this process?
1. .
2. .
If we consume protein in excess of our needs, it is stored as ________________________. The waste product of this reaction is ______________________________.
Fat consumed in excess of our needs is stored in adipose tissue. When energy consumed is inadequate and glycogen stores are depleted, our stored fat is broken down into fatty acids. What else is formed when these are used to form glucose for the brain? _________________________

What happens to our metabolic rate as a consequence of prolonged fasting ? __________

identify at least three environmental influences on our food consumption:
1. .
2. .
3. .
identify which macronutrients best promote satiation and satiety.
Satiation:
Satiety:
list the four main components of energy expenditure:
1. .
2. .
3. .
4. .
We also looked at factors that influence the basal metabolic rate. What is the most significant predictor of basal metabolic rate? ________________________________________

In: Biology

1. How do osmotic power plants work? 2 Research the structures that protect plant and animal...

1. How do osmotic power plants work?

2 Research the structures that protect plant and animal cells from damage resulting from osmotic pressure. Write a few paragraphs explaining what they are, how they work, and where they are located.

In: Biology

Compare the following (with definitions and phylogenetic trees): monophyletic, paraphyletic, and polyphyletic taxonomic groups.

Compare the following (with definitions and phylogenetic trees): monophyletic, paraphyletic, and polyphyletic taxonomic groups.

In: Biology

Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA...

Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator?

A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA

B. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCAAAAAAATTATA

C. TGAAAAACATCGCATTTTAACGAAACGCGCTGCATTTATTTTTTTT

D. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCATTTATTTTTTTT

In: Biology

As a macronutrient, proteins are unique in that they contain which atom ? ____________ There are...

As a macronutrient, proteins are unique in that they contain which atom ? ____________
There are 20 common amino acids. How many of these are essential amino acids? ______________________
Amino acids are joined together by peptide bonds. What reaction takes place to join amino acids together ? ______________________________
Number of amino acids complete the following table.
Peptide

Dipeptide
Tripeptide
Polypeptide
Provide a definition for deamination?

Provide a definition for transamination?

Excess nitrogen needs to be excreted from our bodies. In the form of ammonia, nitrogen is toxic, so our body combines ammonia with carbon dioxide to make urea which can be excreted through the kidneys. What impact does this have on our fluid requirements?

The instructions for making a protein are the __________________________
The template for the instructions is the _______________________________
The amino acid carrier is the ________________________
_____________________ ensures that amino acids are placed in the correct positions
The amino acids are bonded together by the _________________________________

list eight functions of protein:
1. .
2. .
3. .
4. .
5. .
6. .
7. .
8. .

list three examples of food containing high quality protein:
1. .
2. .
3. .
What high quality protein foods would be suitable for consumption by a vegan? ________________


Can you think of two or more foods that you could combine to provide all of the essential amino acids?
1. .
2. .

In: Biology

How specifically is the spinal cord, CNS, and PNS involved in the process of learning a...

How specifically is the spinal cord, CNS, and PNS involved in the process of learning a new language? What function do the parasympathetic, sympathetic, autonomic, and somatic nervous systems have in learning a new language?

In: Biology

1. Because plant and animal life on earth is impossible without photosynthesis A. environmental pollution is...

1. Because plant and animal life on earth is impossible without photosynthesis

A. environmental pollution is not a problem

B. there is concern for increasing numbers of plant species that face extinction

C. worldwide decline of insect diversity is of no concern

D. there is no need to consider conservation biology

2. Reactions with a positive ΔG

can occur as part of coupled reaction

are reactions that can never happen

reactions that do not require activation energy

are exergonic

3. The induced fit is an improved model for enzyme function than the lock and key model because it considers

considers the Gibbs free energy of the reaction

considers specificity of the enzyme

considers the catalytic activity

considers the rate of reaction

In: Biology

miocene hominoid Evolution - 1) is it reasonable to expect that mutation rates are relatively constant...

miocene hominoid Evolution - 1) is it reasonable to expect that mutation rates are relatively constant over long periods of time? what events would significantly alter the mutation rates of a species?

In: Biology

hi, trying to understand the proccess of crebs cycle.. a. If Isocitrate dehydrogenase is inhibited by...

hi, trying to understand the proccess of crebs cycle..

a. If Isocitrate dehydrogenase is inhibited by axcess of citrate, and alpha ketogluterate by axcess of Suc-CoA, what exactly happeneds with the already made citrate and Suc-CoA? do they go back to being Acetyl coA and Alphaketogluterate respectively (and also become into fatty acids, amino acids and purins)?

b. I also don't get how calcium signals for more production of Acethyl coA? who gets this signal? is that the Icam somthing...?

c. in HIF1 degradation in the proteosome, what exactly pVHL and PHD2 do? like what is done individually and what tougether?

d. does HIF1 stop crebs cycle? I only know it encourages anaerobic respiration.. so what proccess does it stop if so? is directly or indirectly?

e. is there any other important substances in the crebs cycle? i remember something said about Fumarate and Succinate is there something worth remembering?

thanks in advance, I am very very lost and my summery is just confusing me.

In: Biology

complete the table below. Type of fatty acidNumber of double bonds Saturated Monounsaturated Polyunsaturated    List...

complete the table below.
Type of fatty acidNumber of double bonds

Saturated
Monounsaturated
Polyunsaturated
  
List three food sources each for saturated, monounsaturated and polyunsaturated fats.
Saturated fat:
1. .
2. .
3. .
Monounsaturated fat:
1. .
2. .
3. .
Saturated fat:
1. .
2. .
3. .
What is the main type of phospholipid in food? ______________________________________
What is its function in the food industry? ___________________________________________
Phospholipids are important components of _____________________________ in the body.
Where does the body receive most of its lecithin from? _______________________________
What type of sterol is found in animal foods? ______________________________________
What is a beneficial function of plant sterols? ______________________________________
List three compounds that our bodies make from cholesterol:
1. .
2. .
3. .
The gallbladder secretes _________________ to emulsify the lipids and make them available for digestion.
The two enzymes secreted into the small intestine to digest lipids are:
1. .
2. .
These enzymes break triglycerides down into:
1. .
2. .
3. .
list the three lipid particles that can be directly absorbed into the bloodstream:
1. .
2. .
3. .
Lipoprotein What does it transport?
What type of lipoprotein is associated with a high risk of heart disease? _______________________
What type of lipoprotein is associated with a lower risk of heart disease? ______________________

How much fat can be stored in adipose tissue? _________________________________________

In: Biology

1. for 1 molecule of glucose (6 C-atoms), the stage of pyruvate processing generates NADH, CO2...

1. for 1 molecule of glucose (6 C-atoms), the stage of pyruvate processing generates

NADH, CO2 and Acetyl CoA

ATP, H+, oxaloacetate

2NADH, 2CO2 and 2Acetyl CoA

2ATP, 2H+, 2 oxaloacetate

2. how many reduced electron carriers after glycolysis, pyruvate processing and citric acid cycle are available to make the ET work

5 NADH, 1 FADH2

4 ATP, 5NADH, 1 FADH2

4 ATP, 10NADH, 2 FADH2

10 NADH, 2 FADH2

In: Biology

you sampled 550 college students and found that 352 have Darwins tubercle. a) what are the...

you sampled 550 college students and found that 352 have Darwins tubercle. a) what are the frequencies of alleles T and t? b) what are the genotype frequencies (TT, Tt and tt) ? c) if the expected allele frequencies are equal, what are the expected genotype frequencies? d) what does this tell you about the population?

In: Biology

Subjects