|
(3) The following is a list of loci from Drosophila melanogaster that have been mapped via linkage studies. The symbols for the loci have been shortened to one letter, and map distances have been rounded. Here are the map distances, in cM, for all pair-wise combinations of the 7 loci:
How many linkage groups are defined by these loci? Draw a map for each linkage group with the locus positions indicated. Include the distances between each neighbor. Example: y x z 4 8 Your map(s): |
In: Biology
This Question refers to the the following Urinalysis Results Chart.
Sample A tests positive for high levels of protein. When a urine sample tests positive for protein, kidney damage could be to blame. High levels of urinary protein can be found in the disease of either hypertension or diabetes, because both can cause kidney damage. However, other results can be used to distinguish between these diseases.
Based on the findings listed in Sample A below, conclude whether this patient suffers from hypertension, or suffers from diabetes. Write your answer in the space below.
| SAMPLE | |||||
| CHARACTERISTIC | Sample A | Sample B | Sample C | Sample D | Sample E |
| Color | light yellow | tinged red | cloudy | cloudy | dark amber |
| Odor | sweet | pungent | foul/fishy | none | none |
| Leukocytes present? | none | none | some | some | none |
| Ketones present? | yes | none | none | none | none |
| pH | slightly acidic | normal | slightly alkaline | slightly alkaline | normal |
| Glucose present? | yes - high | none | none | none | none |
| Protein present? | yes - high | none | none | yes - high | none |
In: Biology
Explain what occurs during depolarization and repolarization in the circulatory system?
In: Biology
An example of a mutualistic nutritional (dietary) symbiosis is that between:
Which pathogen enters via a parenteral route?
In: Biology
Are there similar disease’s that might get confused with this hyperthyriodism?
Compare how you would rule in or out the difference’s between the different diseases similar to this hyperthyriodism?
In: Biology
A researcher studies normal human fibroblast cells.
They can be maintained in culture but die off after about 30 cell
generations. Unexpectedly, a colony of cells continues to survive
and divide past 30 generations. Which scenario is most likely true
for these cells?
In: Biology
Diabetes mellitus occurs with hyposecretion of insulin or hypoactivity of insulin.
Define polyuria, polydipsia, and polyphagia.
Explain why these symptoms occur with diabetes mellitus.
In: Biology
Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below as the top strand in the 5’ to 3’ orientation.
1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt
61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc
121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa
181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga
241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg
301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga
361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta
421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg
481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga
541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga
601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat
661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg
721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt
781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac
841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt
901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga
961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca
1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg
1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt
1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac
1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt
1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag
1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca
Primers have been designed to amplify a specific portion (316 base pairs) of the wild-type gene sequence.
3CF gcaaaagagagagtttcttgctg
3CDR tgcaccatccatacttactttcac
Note: these are in 5’ to 3’ orientation
Question- Locate where the primers will adhere to the sequence and amplify this portion of the gene for identification in gel electrophoresis. Highlight the matching 5’ to 3’ sequencing by changing it to boldface.
1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt
61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc
121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa
181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga
241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg
301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga
361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta
421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg
481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga
541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga
601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat
661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg
721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt
781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac
841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt
901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga
961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca
1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg
1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt
1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac
1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt
1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag
1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca
In: Biology
Paracrine signaling mechanisms and transcription factors have been seen to play key roles in several different developmental processes throughout both the invertebrate and vertebrate animal kingdom.
a. Pick ONE signaling mechanism. Using two different developmental stages/processes, within ONE organism, and describe HOW it is used in each.
Pick ONE signaling mechanism. Using two different model organisms studied this semester, Compare and Contrast how that ONE mechanism is used at the SAME developmental stage/process in each.
In: Biology
Developmental biology THEMES including concentration gradients, time, location/induction, inhibition of an inhibition, negative and positive feedback loops, etc. just to name a few. Pick ONE themes and using three different developmental stages/processes provide three detailed examples of this ONE theme (if possible to do these three stages/processes in one model organism please do so, but if choose to use more than one organism for your examples that is fine).
In: Biology
|
rRNA sequences are among the most highly conserved in nature. What does the word conserved mean in this context? . (1) Why are rRNA sequences so strongly conserved? . (2) |
|
The different stages of translation use several factors that are not a part of the ribosome. What are these factors, meaning what are they made of? . (1) (2) Why are they not considered to be a part of the ribosome? . (2) |
|
The hydrophobic effect helps explain why proteins fold into stable three-dimensional shapes. In other words is one of the most important components of tertiary structure of proteins. Explain how it works. How do both hydrophilic and hydrophobic R groups lead to folding via the hydrophobic effect? (2) |
|
The part of all amino acids that they share includes both a positively charged side group and a negatively charged group. Despite this, most amino acids in actual proteins lack any charge. How is this possible? (2) |
In: Biology
MULTIPLE CHOICE
1. Glutamate plays a specific functional role in
a. synaptic plasticity.
b. anxiety reduction.
c. the action of alcohol.
d. seizure suppression.
2. The most abundant inhibitory neurotransmitter in the brain is
a. Acetylcholine
b. Dopamine
c. Glutamate
d. GABA
In: Biology
Developmental Biology has made substantial contributions to the field of Evolutionary Biology, providing tools that allow us to mechanistically study Darwin’s concept of “Descent with Modification”. This combination of Developmental and Evolutionary Biology has become its own discipline, Evo-Devo. The phenomena of heterotopy, heterochrony, and heterometry can combine in a variety of ways to bring about generational variation in a species that can, in conjunction with natural selection, result in evolutionary changes. “Darwin’s Finches” is an example of this. Provide and Evo-Devo description of how an animal such as a hippopotamus might have given rise, over many generations, to animals like whales and dolphins.
In: Biology
A man is heterozygous for achondroplasia for which the autosomal dominant A allele confers extremely short stature. His wife's genotype is aa and she is normal height. They have five children together. What is the probability that any two of their five children will have the short stature phenotype, in any birth order?
In: Biology