Question

In: Biology

Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below...

Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below as the top strand in the 5’ to 3’ orientation.

        1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt

       61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc

      121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa

      181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga

      241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg

      301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga

      361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta

      421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg

      481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga

      541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga

      601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat

      661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg

      721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt

      781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac

      841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt

      901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga

      961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca

     1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg

     1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt

     1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac

     1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt

     1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag

     1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca

  • Primers have been designed to amplify a specific portion (316 base pairs) of the wild-type gene sequence.

3CF gcaaaagagagagtttcttgctg

3CDR tgcaccatccatacttactttcac

Note: these are in 5’ to 3’ orientation

Question- Locate where the primers will adhere to the sequence and amplify this portion of the gene for identification in gel electrophoresis. Highlight the matching 5’ to 3’ sequencing by changing it to boldface.

1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt

       61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc

      121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa

      181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga

      241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg

      301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga

      361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta

      421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg

      481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga

      541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga

      601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat

      661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg

      721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt

      781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac

      841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt

      901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga

      961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca

     1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg

     1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt

     1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac

     1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt

     1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag

     1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca

Solutions

Expert Solution

The given sequence has 5' to 3' polarity. The primers are synthesized to amplify the template DNA. Therefore, if template DNA is 5' to 3' direction the polarity of primers will be 3' to 5' and vice versa.

For amplification of a gene, a primer pair is synthesized to amplify both strands of DNA hence only one primer sequence can be found in the given template strand. the other sequence will be found on the complementary DNA sequence.

In the given sequence, only one primer can be located as such (in 3' to 5' direction which is complementary to the template DNA). However in order to know the gene sequence which will be amplified using the given primer set, We can predict the complementary sequence of second primer and can locate on the same template strand as shown below.

        1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt

       61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc

      121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa

      181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga

      241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg

      301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga

      361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta

      421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg

      481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga

      541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga

      601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat

      661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg

      721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt

      781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac

      841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt

      901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga

      961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca

     1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg

     1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt

     1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac

     1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt

     1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag

     1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca

gladiator answered 1 year ago
Next > < Previous

Related Solutions

4. In your studies with mice, you have sequenced a piece of wild-type DNA and it...
4. In your studies with mice, you have sequenced a piece of wild-type DNA and it clearly contains a gene, but you do not know what this gene does. Therefore, to investigate further, you would like to create a transgenic mouse to learn more about the phenotypic qualities this gene confers. What kind of transgenic mouse would allow you to correctly determine any phenotypes that depend on this gene’s function? How would you go about making such a mouse?
Determine the genotypes and corresponding phenotypes for the traits listed below. Example: In a plant, purple...
Determine the genotypes and corresponding phenotypes for the traits listed below. Example: In a plant, purple flowers are dominant to white flowers. Answer:    PP = homozygous dominant = purple flowers;  Pp = heterozygous = purple flowers; pp = homozygous recessive = white flowers Part A questions: In a plant, red flowers are dominant to white flowers. In cats, normal tail length is dominant to bobbed tails. In pea plants, yellow peas are dominant to green peas. Part B: Use Punnett Squares...
What type of gamete genotypes can be formed from individuals of the following genotypes? a) aa...
What type of gamete genotypes can be formed from individuals of the following genotypes? a) aa b) AaBB c) AaBbcc d)AaBbCc e)aaBbccDDEE
What information on the evolutionary history of animals has been obtained from fossils and from genotypes...
What information on the evolutionary history of animals has been obtained from fossils and from genotypes of modern species? List 2 or 3 major events in this history
DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and...
DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and translate the wild type and mutant proteins. 2. Classify the type(s) of mutation(s) in gene A the mutant has. 3. Design a primer pair to generate a PCR fragment of any size from the wild type sequence. Write the primer pair and mark the 5’ and 3’ of each primer sequence. wild-type gene 5’  TAG|ACC|ATG|CCA|GTA|AAT|TTA|CGA|TGA|CA 3’ 3’  ATC|TGG|TAC|GGT|CAT|TTA|AAT|GCT|ACT|GT 5’ mutant 2 5’ TAG|ACC|ATG|CCA|GTA|AAT|ATG|TTA|CGA|TGA|CA 3’ 3’ ATC|GGG|TAC|GGT|CAT|TTA|TAC|AAT|GCT|ACT|GT...
Sally has blood type B- and her daughter Sophia has A-. List the possible genotypes for...
Sally has blood type B- and her daughter Sophia has A-. List the possible genotypes for Sally and Sophia. Given the information in the question above, which of the following men could be Sophia’s father? Jim B+ Charlie O- George B- Fred A+ Bob, who is B+, has fathered a child AB-. Give the possible genotypes for Bob and the mother.
3. Listed below are the phenotypes of the offspring from a pizza self fertilization experiment regarding...
3. Listed below are the phenotypes of the offspring from a pizza self fertilization experiment regarding the traits of toppings and crust thickness. Yeah that’s right, in my dream world pizza can self fertilize. AND THEN I EAT IT ALL. offspring phenotype # of offspring cheese, thin crust 67 veggie delight, thin crust 22                cheese, thick crust 197 veggie delight, thick crust 64 What is the dominant phenotype for pizza toppings? OK. So, in looking at these data, do you...
You are interested in the genetics of flower colour determination in daffodils. The wild type has...
You are interested in the genetics of flower colour determination in daffodils. The wild type has yellow flowers. In a genetic screen, you isolate two mutants with white flowers. Suggest and explain experimental strategies to answer the following questions: I. Is each of the mutants defective in a single or multiple genes? II. Assuming that the mutants are defective in a single gene, are the mutations recessive or dominant to the wild type gene? III. Assuming both mutants are affected...
You are interested in the genetics of flower colour determination in daffodils. The wild type has...
You are interested in the genetics of flower colour determination in daffodils. The wild type has yellow flowers. In a genetic screen, you isolate two mutants with white flowers. Suggest and explain experimental strategies to answer the following questions: i) Is each of the mutants defective in a single or multiple genes? ii) Assuming that the mutants are defective in a single gene, are the mutations recessive or dominant to the wild type gene? iii) Assuming both mutants are affected...
Create a geoprocessing tool from the .py file included (script from this file included below). Use...
Create a geoprocessing tool from the .py file included (script from this file included below). Use any csv file you would like. I will work around that. This is for a programming for GIS class. We work with jupyter, idle, arcgis pro import os import arcpy from arcpy import env input_table = r"C:\Answers\January2018.CSV" output_fc = r"C:\Answers\crime.gdb\January2018_Crime" spRef = arcpy.SpatialReference("NAD 1983 StatePlane Missouri East FIPS 2401 (US Feet)") gdb_name = os.path.dirname(output_fc) fc_name = os.path.basename(output_fc) env.overwriteOutput = True print("Creating File GDB") arcpy.CreateFileGDB_management(os.path.dirname(gdb_name),...
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT