Discuss the interaction of heredity and the environment in producing individual traits and provide a specific example.

Explain what is the advantage of the C4 plants(in 250 words)

Describe the parts of the brain neuron including; the axon ; the dendrite ; what are neurotransmitters? ;what are vesicles? ; describe the Synapse ; what is the function of receptors; what is the Action Potential; and explain synaptic reuptake

Which of the following is NOT directly associated with translation?

A) Elongation of the polypeptide

B) Formation of peptide bonds

C) Complementary base pairing between codon and anticodon

D) mRNA synthesis at the ribosome

E) Transfer of amino acids by tRNAs

Imagine if you could tinker with any component of the signal transduction pathway involved in vision in vertebrates. In this problem, you will predict the effect of a change in the activity of a single component of the signal transduction pathway in vision. The rod cell secretes the neurotransmitter glutamate onto the bipolar cell as a function of its membrane potential – the more depolarized, the more it secretes; the more hyperpolarized, the less it secretes. The bipolar cell in this case (ON bipolar) has glutamate receptors that cause closure of cation channels, hyperpolarizing their membrane. They synapse with ON ganglion cells and secrete acetylcholine into the synapse at a rate that increases with increased depolarization of the bipolar cell membrane. The ON ganglions have acetylcholine receptors that are ligand-gated ion channels. The ganglion cell responds by sending a train of action potentials to the brain; the frequency of these action potentials is a function of the amount of acetylcholine that they sense. In your experiment, you will expose the rod cells to a controlled light pulse (same length and intensity every time) and measure the output of the ON ganglion cells to which they are connected. Then you will repeat this in each perturbed system. In each case, predict whether the frequency of action potentials sent out by the ON ganglion in response to light will be HIGHER or LOWER than the unperturbed system.

• You express a version of rhodopsin that stabilizes 11-cis retinal relative to all-trans retinal                              [ Select ]                       ["HIGHER", "LOWER"]      
• You mutate the transducin (G_t) beta subunit such that it has much higher affinity for the transducin (G_t) alpha subunit bound to GTP (G_tα-GTP)                              [ Select ]                       ["HIGHER", "LOWER"]      
• You mutate the inhibitory subunit of cGMP phosphodiesterase (PDE) such that it has lower affinity for the catalytic subunit of PDE.                              [ Select ]                       ["HIGHER", "LOWER"]      
• You add a drug that mimics the effect of cGMP: it binds to the ligand-gated Na⁺/Ca²⁺ channel and opens it. However, this drug is not affected by PDE.                              [ Select ]                       ["HIGHER", "LOWER"]      
• You use CRISPR/Cas9 to delete the gene for rhodopsin kinase.

Answer the following questions based on this codingstrand of DNA:                                    

                                    5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’

Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand).

1. Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’.
2. Write the mRNA sequence for this patient and clearly highlight the change you made. Write it 5’ to 3’.
3. Write the amino acid sequence for this patient, highlight what differs from the normal (wildtype) sequence.
4. What type of mutation is this? (insertion, deletion, silent, nonsense,missense,or frameshift mutation? Explain your reasoning.

Sea cucumbers (see figure) are classic hydrostats- cylindrical in shape with a body wall surrounding a constant volume of water. Many sea cucumber species crawl along the substrate using peristaltic locomotion (waves of alternating muscle contraction) while some species burrow into the substrate, which requires force to displace sediment. How might (a) the fiber angle of the collagenous body wall and (b) the initial shape of the animal correlate with peristaltic locomotion versus burrowing?

In osmosis, when will there be changes in volume of the two compartments separated by a selectively permeable membrane?

Climate change and an increasing population present an unprecedented challenge for food security in the coming decades. Propose and justify one or more ways in which we could increase or safeguard food production.

What do we know about Homo floresiensis? How old is it, where did it live, what did it look like? And, why is this a considered, by many, to be a controversial find?

What is meant by race? If you had a friend who told you that there were three clearly defined races, and another friend insisted that there were really five races, would you agree or disagree with each of them and why? Why can’t everyone agree on the number of races existing in the world today (what problems arise when people attempt to define someone by race)?

What is a polytypic species and what does it mean when one states that humans are members of the same polytypic species?