Questions
a) Characterization of cell lines are important phenomena for cell culture experiments. Discuss briefly why we...

a) Characterization of cell lines are important phenomena for cell culture experiments. Discuss briefly why we need to carefully characterize cell lines.

, b) What is the simplest cell characterization technique? Based on this characterization you observed one cell line fibroblastic and the other one epithelial. Please briefly explain their morphologies.

c) What would be the consequences of working with not properly characterized cell lines?

d) How would you sterilize liquid based materials that is used in cell culture experiments?

In: Biology

How do light, reaction centers, antennae complexes, and bacteriochlorophyll together cause an electron to have a...

How do light, reaction centers, antennae complexes, and bacteriochlorophyll together cause an electron to have a very low E (i.e. a negative number with a large absolute value) in photophosphorylation?

In: Biology

what form/s of MAPK does the anti-total map kinase antibody detect, and what form/s of MAPK...

what form/s of MAPK does the anti-total map kinase antibody detect, and what form/s of MAPK does the anti-active map kinase antibody detect?

In: Biology

The body system that stimulates eating or drinking is the ________ system. stimulatory circulatory nervous lymphatic...

The body system that stimulates eating or drinking is the ________ system.

stimulatory
circulatory
nervous
lymphatic

Marci has been diagnosed with gluten sensitivity. She therefore needs to experiment with

Marci has been diagnosed with gluten sensitivity. She therefore needs to experiment with

grains such as teff, quinoa, buckwheat, amaranth, and millet.
lean meats, and low-dairy products.
Beano.
products which are made with cereals such as wheat, whole wheat, rye and barley.

From the list below, choose all of the correct symptoms of celiac disease that affected individuals may present with.

Select all that apply.

Select all that apply.

diarrhea
fatigue
excess energy
weight gain

chronic stomachache

Choose the correct description/statement about gluten from the list below.

Choose the correct description/statement about gluten from the list below.

Gluten is a kind of carbohydrate molecule, which is why it is found in grains and other starchy foods.
Gluten is found in all fruits and vegetables.
As long as a food contains no wheat, it is gluten-free.
Gluten is a protein that causes an autoimmune reaction in people with celiac disease.
People with celiac disease should avoid gluten-containing grains like quinoa, millet, and corn.

Elizabeth is seated with her friend at her favorite restaurant. It’s the first time she has eaten out after beginning her new diet. She wants to be sure to choose gluten-free items from the menu. She orders sparkling water with lemon and the grilled salmon with sautéed kale and mushrooms. The waiter reminds her that she can choose one more side dish.

Which of the following side dishes is gluten-free and, therefore, safe for Elizabeth to eat?

Elizabeth is seated with her friend at her favorite restaurant. It’s the first time she has eaten out after beginning her new diet. She wants to be sure to choose gluten-free items from the menu. She orders sparkling water with lemon and the grilled salmon with sautéed kale and mushrooms. The waiter reminds her that she can choose one more side dish.

Which of the following side dishes is gluten-free and, therefore, safe for Elizabeth to eat?

fried, dipped onion rings
baked potato with a small dollop of sour cream
macaroni and cheese
organic whole-wheat bread sticks with spiced olive oil dip
mashed potatoes with gravy

In: Biology

Does Rh factor inheritance follow Mendelian genetics? If yes, which kind of dominance is it? How...

Does Rh factor inheritance follow Mendelian genetics? If yes, which kind of dominance is it?

How can a fetus with Rh+ for a mother who is Rh- can be saved if he is the second baby for her?

In: Biology

When analyses enzyme-kinetics, what can we know with Michaelis-Menten equation? Write down everything you can.

When analyses enzyme-kinetics, what can we know with Michaelis-Menten equation? Write down everything you can.

In: Biology

I am currently studying experimental analytical assays such as: 1. deletion analysis + reporter assay 2....

I am currently studying experimental analytical assays such as:

1. deletion analysis + reporter assay
2. linker scanning mutation assay
3. DNase I foot-printing assay
4. Electrophoretic mobility shift assay
5. ChIp-Seq

And I would like to look further into the applications of these methods. I am particularly comfortable with (1), (3), and (4) so any suggestions on an experiment I could test would be much appreciated. Not looking to do anything too complex but just something interesting and simple. I know that this isn't the typical homework question, but we do have to write about a paper about such an experiment that uses one of these methods.

In: Biology

Why are parasitic nematodes generally ubiquitous and difficult to control?

Why are parasitic nematodes generally ubiquitous and difficult to control?

In: Biology

Illustrate the evidence provided by Mendel’s experiments in disproving the blending theory of inheritance.

Illustrate the evidence provided by Mendel’s experiments in disproving the blending theory of inheritance.

In: Biology

1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats...

1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats contains three (3) molecules of glucose.
a. Assuming Princes uses 180 molecules of adenosine triphosphate in consuming breakfast and cleaning up after breakfast, calculate the net ATP Princes has from breakfast for her morning activities. ​​​​​​​​
b. Describe how Princess generates the net energy from ATP by substrate level phosphorylation for her biology exam. ​​​​​
c. State the total number of ATP generated from oxidative phosphorylation. Describe how this number is generated. ​​​​​​​

2. You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below:
3’CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5’

Additional tools are provided below.

a. Provide the complementary strand for the parent strand (above) that would be synthesized during replication of the linear DNA fragment ​​
b. List the enzymes involved in this DNA replication ​​​
c. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is generated and regulated. Indicate the direction of synthesis.


d. Synthesize a polypeptide from the mRNA.​​​​
TOOLS:

a. Primer: GUGAUU
b. Codon table







In: Biology

How has the bacterium Y. pestis evolved to become virulent (based on your assigned literature and...

How has the bacterium Y. pestis evolved to become virulent (based on your assigned literature and other literature)? [15 points]

In: Biology

Hermione is using a combination of glyburide and pioglitazone for the treatment of type II diabetes....

Hermione is using a combination of glyburide and pioglitazone for the treatment of type II diabetes. Her condition is stable as she remains relatively compliant with her treatment. At her bachelorette party, she drinks a more than what she is used to, and faints soon after thereafter. Before fainting she experienced an elevated heart rate and confusion. She is rushed to the hospital, where they administer IV glucose and dextrose. Regarding the presentation, i) explain the underlying reasons leading to her fainting, and ii) why she received glucose as emergency treatment.

In: Biology

where does cellular respiration take place? A. Chloroplasts B. Mitochondria C. Nucleus D. ER E. Golgi

where does cellular respiration take place?

A. Chloroplasts
B. Mitochondria
C. Nucleus
D. ER
E. Golgi

In: Biology

Write 75- to 100-word paragraph that summarizes the symptoms and pathology of the disease Werner Syndrome?...

Write 75- to 100-word paragraph that summarizes the symptoms and pathology of the disease Werner Syndrome? (premature aging). Your paragraph should include the information listed below, as well as other interesting, relevant information.

Information should include:

o What are the characteristic manifestations and complications of the disease?

o What is the mode of inheritance? What is its penetrance and expressivity?

o What is the main type (responsible for the majority of cases) of mutation involved? What gene is mutated?

o By what molecular/cellular mechanisms does this mutation cause the disease? o   Why is your topic important and/or interesting?

In: Biology

Why do the pole cells (the primordial germ cells which give rise to the gametes) form...

Why do the pole cells (the primordial germ cells which give rise to the gametes) form so early in Drosophila melanogaster development?

In: Biology