What are different mechanisms through which genetic variation occurs? Describe the mechanism in detail in which a specialized plasmid plays a role for genetic variation to occur.

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.

a) Underline the promoter region of this gene by a dotted line.

b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?

c) Deduce the nucleotide sequence of mRNA for this gene.

d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino

acids does this mRNA code for? What is the sequence of the codons in this mRNA?

e) Show 5’ and 3’ ends of the template strand and mRNA.

f) What are the -10 and +10 base pairs of this gene?

CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

6. The final step in the infectious process is disease production (or pathology). By what major mechanism can an infection with microorganisms result in disease? Give an example of each mechanism for the pathogens.

A 68 year old women was admitted to a hospital because of headaches that began a month earlier. She was in good health, prior to developing severe headaches, vertigo, photophobia, lethargy, and forgetfulness. Her temperature was 98.9 degrees F, and she knew her name but not the date. She had some resistance to bending her neck, consistent with mild inflammation of the meninges. She also had past-pointing when reaching for objects. A lumbar puncture revealed a total white blood cell count of 18/microliter ( normal is up to 4) and 75% polymorphonuclear leukocytes. CSF glucose was low suggesting a microbe was present in the subarachnoid space. The lab tech performing the wbc count noticed cells that were not wbc. To investigate further, the tech centrifuged the CSF, and stained the sediment with India ink. The round cell appeared to be budding, much like yeasts. In addition, the cell appeared to have a capsule.

1. What type of microbe could be causing the meningitis? Give one reason to support your answer based on the information provided.

2. Of the following eukaryotic microbes, which one is characterized by having polysaccharide capsules? Candida albicans, Histoplasma capsulatum, Crytococcus neoformans.

In July of 2003 a construction worker came to a hospital in Palm Beach County complaining of fever, headaches, chills, nausea and malaise. After being treated for dehydration he was discharged. Two days later he returned to the hospital with worsening symptoms, and was admitted with a diagnosis of malaria. The next day his blood smear revealed Plasmodium. During July and August a plumber who worked outside, a fisherman who fished in the evenings, a golfer, a homeless individual, a carpenter and an outdoorsman all had Plasmodium infections. Six of the seven men had never traveled to a malarious region, none had had recent blood transfusions or was an IV drug user. Targeted mosquito trapping produced no Plasmodium-infected mosquitoes.

3. What could an epidemiologist infer from the interviews of the seven patients? What disease did all seven have?

4. How is this disease transmitted? How was it transmitted in this case?

Describe how chromosome rearrangements may be produce by breakage or crossing over between repetitive DNA sequences

1. Find one new fossil discovery, how it did/did not change what is already known for species related to the discovery and how it relates to Darwin’s theory of evolution

2. DNA evidence of changes to the evolutionary tree that is currently accepted

3. Find one new human DNA or fossil or anthropological discovery and explain how it relates to Darwin’s theory of evolution

4. Choose a new method of artificial selection for crops or animals (pets or livestock usually) and explain its connection with Darwin’s theory of evolution.

Full research about the biological human signals (ECG, EMG, EEG) time domain and frequency domain analysis (showing all the calculations, diagrams, graphs, wave signals, simulation or a design, Matlab wave, or signal) basically anything related to this topic. (1000 words)

write a 2 to to three-page essay about National Geographic Society and its mission and main actions.

Renal physiology (select the CORRECT statement)

During the golden age of antibiotic discovery, many new antibiotics were isolated from the soil. Recent studies have found that soil bacteria are naturally resistant to most antibotics. Some of the soil bacteria may even use antibiotics as a nutrient source. Antibiotics must kill a broad spectrum of bacteria while being absorbed harmlessly by the body. Most antibiotics were developed based on Ehrlich "magic bullet" paradigm which is suited to testing antibiotic efficacy in a lab. However, infections are more complex than a pure culture on media in a petri plate. Antibiotic resistance conjures up the pre-antibiotic era of medicine in the early 20th century. The emergence of a plasmid mediated resistance to carbopenems, a last-line drug against a variety of bacteria was alarming to public health workers. Antibiotics may cause collateral damage like a C. diff infection that leads to colitis.

5. Why is a bacterial infection that involves a biofilm harder to control with antibiotics than an infection which does not involve a biofilm?

6. Explain how taking antibiotics would cause the bacteria Clostridium difficle, which is part of the healthy colon microbiome, to become pathogenic?

7. How do bacteria resist antibiotics?

Bacteria also develop resistance to biocides. Traditional cleaning methods for equipment may have limitations. For example, patients who recieve a bed used by a prior patient with a bacterial infection are at an increased risk for being colonized and infected by that same bacteria. In addition, bacteria in a healthcare setting are exposed to disinfection which selects for the resistant members of that bacterial population. No-touch methods of disinfection, i.e. uv light or hydrogen peroxide vapor, of equipment may be an improvement. https://www.ncbi.nlm.nih.gov/pubmed/29214175# (Links to an external site.)Links to an external site..

8. Are biofilms a concern when disinfecting equipment? Why?

During the Flint, MI water crises as levels of chlorine fell in the drinking water cases of Legionnaires' disease increased. Legionnaires' disease is a water borne infectious disease caused by Legionella. One study reported that for every drop in cholorine concentration of mg/L of river water the odds of a reported case of Legionnaire's disease increased by 80%, thus establishing not causation but association. Some argued that Legionella is tolerant of chlorine, espceillay when it grows in biofilms and that the temperature difference between lake and river water accounts for the increase in Legionella infections. The recommended level of chlorine to treat water for drinking is 0.2-0.5 mg/L.

doi:10.1126/science.aat2210 Was Flint’s deadly Legionnaires’ epidemic caused by low chlorine levels in the water supply? David Shult (Links to an external site.)Links to an external site.z

Was Flint’s deadly Legionnaires’ epidemic caused by low chlorine levels in the water supply?

9. What effect would increasing the concentration of chlorine to 1.4 mg/L have had on the people who drink Flint water?

10. What happens to the water pipes when chlorine levels are increased to control bacteria? Could these uninteded consequences increase bacterial growth?

Renal physiology (select the INCORRECT statement)

4. (10 pts) Hemoglobin S or sickle cell hemoglobin forms fibers in red blood cells because
of a Glu→Val mutation on the surface of the protein. The mutated residue interacts
with Leu and Phe residues located on the surface of a different protein molecule. This
interaction drives the formation of the fibers. Explain why higher concentrations are needed to form fibers at lower temperatures.

One very diverse group of eukaryotic microbes are protozoa. All protozoa are eukaryotic, unicellular and lack cell walls. Many protozoan are chemoheterotrophs, getting energy and carbon from other organsims. Two groups of protozoans that are photosynthetic are dinoflagellates and euglenoids. Protozoans are divided into six groups: Parabasalids have a Golgi like organelles, a parabasl body, and lack mitochondria. Examples: are 1. Trichonympha which live in the guts of termites and digest cellulose into glucose. 2. Trichomonas which lives in the acidic environment of the human vagina, if the pH is increased, it can proliferate and cause inflammation which might lead to sterility. Diplomonadida lack mitochondria and have two rudimentary mitochondria called mitosomes, two equal size nuclei and multiple flagella. An example of this type of protozoan found in well water or lake water if Giardia, the ingestion of cysts leads to a GI infection characterized by flatulence and diarrhea. This protozon looks owl like in a light microscope because of the two nuclei. Euglenoza Euglenids:lack cell walls, have flagella, are chemoheterotrophic phagocytes in the dark, and have several features unique to euglenids. For one they store energy in a polysaccharide paramylon. They may move by a squirming motion called euglenoid movement. They have a protein pellicle under thier plasma membrane to give the cell shape. Most have a "red eyespot" that helps with phototaxis. Kinetoplastids have a single large mitochondria that contain a kinetoplast Two notable pathogens in this group are Trypanosoma and Leishmania. Alveolates have small membrane bound cavities beneath the plasma membrane called alveoli. In addition, alveolates have tubular mitochondria cristae. There are three subgroups. Ciliates have cilia for motility or to move water past the cell surface. Ciliates are chemoheterotrophic and have two nuclei. The only pathogenic ciliate is Balantidium. Paramecium is a well known pond dweller used to study regeneration. Apicomplexans are chemoheterotrophic animal pathogens. They contain apices which are organelles that contain enzymes that allow the protozoan to penetrate host cells. Three examples of apicomplexans are Plasmodium, cryptosporidium and Toxoplasma.

12. According to CDC toxoplasmosis is a neglected parasitic disease. Cats play an significant role in transmitting the protozoan because cats become infected by eating infected rodents or birds. An infected kitten may shed as many as a million cysts in thier feces for up to 3 weeks after infection. Humans may become infected by changing cat litter boxes or gardening without gloves. Suggest at least two ways a person may prevent infection based on this information. You may also visit the CDC websitehttps://www.cdc.gov/parasites/toxoplasmosis/gen_info/pregnant.html (Links to an external site.)Links to an external site..

Bateman’s Principle is based on the concept of Anisogamy. Explain Bateman’s Principle and Anisogamy and explain how this relates to Sexual Selection. Does Bateman’s Principle predict that animals should exhibit a Polygamous Mating System? And, if so, why does Monogamy exist?