In 200-250 words answer: What is artificial photosynthesis and how does it work? Provide a detailed description, which includes naming the key components, their functions, and their counterparts within the chloroplast. What is biomimicry and why is artificial photosynthesis a good example? How do we currently retrieve and produce energy? List at least two problems with our current energy source and explain how artificial photosynthesis resolves these problems.

Summarize how cellular respiration and photosynthesis are important to the carbon cycle.

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC

The strand is transcribed from left to right and codes for a small peptide.

a) Is this the mRNA-like coding strand or template strand?

b) Which end is the 3' end and which is the 5' end?

c) What is the DNA coding strand sequence of the ORF ?

d) What is the sequence of the entire transcript (assume the +1 of transcription begins at the first nucleotide shown)?

e) What is the amino acid sequence of the peptide?

Explain how you can use a filter paper to sterilize a liquid drug to make it safe for someone with immunodeficiency. What type of filter should you use?

The Potassium Channel is a protein that lives in the plasma membrane in both eukaryotic and prokaryotic cells. Describe the path that the Potassium Channel takes to end up in the plasma membrane of eukaryotic cells and the path it takes in prokaryotic cells (starting from it’s DNA sequence).

3 quotes of marine biologists about their careers with names of the person who said it.

Genetics: Combined Factor V & VIII

Part 1: Describe what happens to the product of the gene that causes the double clotting factor disorder in the ER and the golgi apparatus.Describe what happens to the product of the gene that causes the double clotting factor disorder in the ER and the golgi apparatus.

Part 2: What is the evidence that a mutation in a single gene causes this double deficiency? That is, how does the inheritance pattern differ from what it would be if families inherited each condition independently?

5) Every vertebrate is a chordate but not every chordate is a vertebrate. Compare the three groups we discussed in the non-vertebrate chordate lecture (Hemichordata, cephalochordate, urochordata) and explain the differences between the following in one or two paragraphs:

i) between the groups

ii) between those phyla and the vertebrates.

iii) describe the relationship of the hemichordates to other deuterostomes.

iv) What physical feature found in all of these groups is an advantage that has led to “pre-adaptedness” in the chordates? What does that physical feature allow that creates this opportunity?

Why do you think the topic of Early Human migration to America is controversial for archaeologists?

Based on the structures of the fungus Gymnopilus ventricosus below, which phylum does it belong to?

A.) Ascomycota

B.) Basidiomycota

C.) Chytridiomycota

D.) Glomeromycota

E.) Zygomycota

1. (3) How could you tell if a plant you have found is a sporophyte or a gametophyte? Use your imagination and describe an experiment you could do.

2. (3) a. Explain why the sporophyte is “dependent” on the gametophyte in the moss and the fern.

b. Which is the “dominant” form in each of these?

Distinguish between a Zygomycete and a Basidiomycete. What is similar and what is different? (3) Answers must include the sexual cycle details. Including a drawing would be very helpful.

What are the history and steps of the next-generation sequencing in DNA tools and technology?

draw an example of the hierarchy of life that starts with a species and goes on and on

What is found at each different level?