1.)

Out of the five main population ecology characteristics, pick three of them and explain how they are relevant to the current Covid-19 crisis.

Identify three biomes with poor soil quality and explain why.

Which of the following three signals are required for the activation of naïve T cells?

a. TCR bound to MHC-Ag complex, costimulation, and granzymes

b. TCR bound to MHC-Ag complex, costimulation, and cytokines

c. NF-kB, NFAT, and PI3-Akt signaling

d. CD40 bound to CD40L, CD80 bound to CD28, and IL-12 production

e. IL-1, IL-6, and TNF

A nurse is reviewing the urinalysis of a patient admitted to the hospital with a urinary tract infection, nausea and vomiting. The following urine and blood results were obtained:

Urine

Urine specific gravity              1.030

Color                                       Dark Amber

Protein                                     2+

Blood trace

Blood

BUN                                       40

Creatinine 1.2

How would you interpret the importance of the urinalysis?

What is the importance of the BUN and creatinine?

Discuss one disease process that could elevate the BUN.

What four organ systems work together in hand with two major nutrients, excluding water, two minerals and two vitamins and demonstrate how they work together, describe how the organ systems you selected use these selected nutrients in a cooperative manner.

Explain why combination therapy (e.g. 3 drug cocktail for HIV infections) can (1) better attack a specific pathogen than a single drug, and (2) greatly suppresses the rate at which pathogens (especially bacteria and viruses) evolve to be resistant.

The redundancy of the genetic code relates to all of the following EXCEPT

the difference in the number of amino acids compared to the number of base pair combinations

the ability to produce multiple transcripts through alternate splicing

protection of important coding sequences against the effect of point mutations

the ability of tRNAs to base pair with multiple codons through wobble base pairing

A human hemoglobin variant occurs in certain populations. The variant hemoglobin is slightly defective in its oxygen carrying function, causing a mild anemia. Normal alpha-hemoglobin has 141 amino acids, while the variant α-polypeptide is 150 amino acids long.

Beginning with the final amino acid coding codon (CGU Arg) the 3' region of the normal α-globin mRNA has the sequence:

5’ ...CGU UAA CCU UCG GUA GCA UGU GAU CCU CAC UAG GCC UCC GGG... 3’

a) Based on this information, explain how the variant α-hemoglobin is likely generated.

b) What is the sequence of the four C terminal amino acids of the variant α-hemoglobin.

1. The following questions are in regard to loss of heterozygosity [LOH].

a) Illustrate the process of LOH making certain to show what happens in the parent and the two daughter cells.

b) Explain why LOH is more likely to result in tumor suppressor gene inactivation in a cell as compared to independent sporadic mutations.

Alex has a single mom who became pregnant when she was 18. The pregnancy was unplanned and Tara never married the father. Tara had to work during the entire pregnancy and was ostracized from her friend group for becoming pregnant during high school. The father also was abusive emotionally and physically until Tara cut off contact with him during her third trimester. She has minimal support from her parents but did graduate high school. She does take some community college courses while working at Lowe’s as a cashier and at a diner on the weekends as a waitress. She wants to improve her life and give her child the best life she can. She visits the library often to check out books for her daughter and herself. While she was pregnant, Tara did not have insurance but did visit the free clinic during her pregnancy. She lives on her own and occasionally her parents will babysit Alex if there is a problem with daycare. Alex usually spends 8-9 hours 5-6 days a week in daycare.

Obstacle/Challenge: Alex's family home has sustained terrible damage from a hurricane. Alex's mother and family are experiencing major trauma from the hurricane that has leveled their house. How does a stressor in utero impact the development of the 3 domains?

You will do some research using the article provided below along with your other course materials. Then write at least 3 paragraphs that explain how the obstacle impacts each developmental domain of the child/person. You need to include both the life scenario you have been assigned to and the obstacle presented.

· at least one paragraph explaining how the obstacle impacts the physical development of Alex in utero

· at least one paragraph explaining how the obstacle impacts the cognitive development of Alex in utero

· at least one paragraph explaining how the obstacle impacts the socio-emotional development of Alex in utero

Using approximately 200 words, select a city or town preferably in new jersey and discuss various aspects about the population and how it compares to that of the US overall. please write in your own words

you can find it online one census bureau

Please transcribe and translate the gene provided.   Please provide the code for the non-sense strand of DNA too.

Make sure you label the 3’ and 5’ ends of the nucleic acids, as well as the amino (NH3) group and the carboxyl (COO-) group of the peptide.

3’- CAATAATACGTGAAATAACCTTTATCAACGACGATCAGAGAG –5’

1. What is the function of a centromere?
2. Draw the correct order of the steps of mitosis, label them, and state what occurs in each (this should not be a picture from the internet)?
3. Why is apoptosis required to balance mitosis?
4. What is binary fission?
5. What are cell cycle check-points?
6. What are the difference between proto-oncogenes and tumor suppressor genes? How to these impact the cell cycle?
7. What are some life styles choices that can increase your risk of cancer? How about decrease?

1. What are two examples of ‘molecular switches’ from our current material? What acts as the ‘switch’ in each case?

What are the major structural differences between the fetal and the adult human heart? Draw and label these differences on your diagram of the fetal heart. How do these structures alter the circulation of blood?