Question

In: Biology

.If DNA from a crime scene must be compared to other DNA patterns to determine whose...

.If DNA from a crime scene must be compared to other DNA patterns to determine whose DNA it is why is it considered to be more accurate that fingerprinting?

Solutions

Expert Solution

ANSWER :-

  1. According to me, it should be the Fingerprints which are more reliable than the process of DNA fingerprinting.
  2. Fingerprints are being collected by means of using various chemical agents such as cyanoacrylates which are responsible for providing visibility to the fingerprints which are being imprinted at the crime scene. This plays an important role in recording the certain characters of fingers such as the impressions which are specific for every individual and this can be recorded in an electronic format as a record. This when matched along with the probable suspects are being used to determine the character similarity between the two on the basis of which a judgement is being given whether the crime is being committed by the suspect or not.
  3. In case of DNA fingerprinting, there are more errors associated as compared to that in terms of fingerprint collection at the crime scene. DNA fingerprints can show certain changes or dissimilarities which is usually expressed in terms of percent similarity. More the similarity, more the chances of finding out the culprit although most courts rely on having similarities more than 96% to proceed to any conclusion. This makes fingerprints more acceptable than the process of DNA fingerprinting.

Related Solutions

1. Why can’t the DNA from a crime scene sample be extracted, fragmented and immediately run...
1. Why can’t the DNA from a crime scene sample be extracted, fragmented and immediately run on in an Argos rose gel electrophoresis? 2. Why is it necessary to stain the electrophoresis gel before measuring it?
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ                                                                                           3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...
In electrophoresis of suspect DNA in the crime scene, what does it mean when when we...
In electrophoresis of suspect DNA in the crime scene, what does it mean when when we say that DNA samples were fragmented? What would your gel look like if the DNA was not fragmented? Explain using scientific evidence (10 points)
The crime scene investigator must always be aware of the potential value of fiber evidence in...
The crime scene investigator must always be aware of the potential value of fiber evidence in any investigation. Describe three or more methods of the proper collection and preservation of fiber evidence in a criminal investigation. (An excellent answer would include at least four major points.)
briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime...
briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime scenes.
Inventory investment displays business cycle patterns that differ from other forms of expenditure because
Inventory investment displays business cycle patterns that differ from other forms of expenditure because inventory investment is countercyclical, but expenditures are generally procyclical. inventory investment is procyclical, but expenditures are generally coincident with the business cycle. inventory investment displays large fluctuations that are not associated with business cycle peaks and troughs. inventory investment lags the business cycle, but expenditures generally lead the business cycle.
From the end of a string (whose other end is firmly attached to the ceiling) we...
From the end of a string (whose other end is firmly attached to the ceiling) we attach a mass m1.Similarly, we attach a mass m2 from the end of a different string. Both strings have equal lengths and the masses are barely in contact when they are hanging freely. We pull out both masses so that they form angles θ1and θ2, respectively, with their equilibrium (vertical) positions. We then release the masses such that there is an elastic, heads-on collision...
Lisa wants to determine if graduates from her college earn different incomes compared to graduates from...
Lisa wants to determine if graduates from her college earn different incomes compared to graduates from college in general. To test this, Lisa sends surveys to 1,000 graduates from her school and finds that the average income is $40,000 ( s = 5,000). If the average income is $45,000 for graduates in general, do graduates from Lisa's school differ significantly? Report the results in APA style and be sure to include information about effect size.
In a location in outer space far from all other objects, a nucleus whose mass is...
In a location in outer space far from all other objects, a nucleus whose mass is 4.019480 × 10−25 kg and that is initially at rest undergoes spontaneous alpha decay. The original nucleus disappears, and two new particles appear: a He-4 nucleus of mass 6.640678 × 10−27 kg (an alpha particle consisting of two protons and two neutrons) and a new nucleus of mass 3.952926 × 10−25 kg. These new particles move far away from each other, because they repel...
How are interpersonal stressors different from other stressors? Why are interpersonal stressors often so concerning compared...
How are interpersonal stressors different from other stressors? Why are interpersonal stressors often so concerning compared to stress related to things?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT