Questions
Research in cell biology and metabolism has progressed due to the discovery of molecules that artificially...

Research in cell biology and metabolism has progressed due to the discovery of molecules that artificially stimulate or inhibit glucagon/epinephrine and insulin signaling pathways. Let’s say you are working in a lab cataloging the effects of a library of small molecules on these pathways and have a “hit” on molecule 1stAVNGR. Preliminary data on molecule 1stAVNGR indicates that the cardiac isoform of PFK2/FBPase2 is doubly phosphorylated when this molecule is present at micromolar concentrations in cell cultures. Given this context answer the following questions.

a. Under these conditions what is the predicted degree of association between the regulatory subunits and the catalytic subunits of PKA?

b. Further investigation of molecule 1stAVNGR indicates elevated levels of cAMP within the cell despite the absence of epinephrine or glucagon. Hypothesize two possible explanations for this data.

c. When cell cultures are given both molecule 1stAVNGR and molecule RedSKLL (a G-protein inhibitor) cAMP levels remain high (again despite the absence of epinephrine or glucagon). Given this new information hypothesize a possible explanation for the data.

d. In consideration of the data presented in this problem what would be the expected effect of molecule 1stAVNGR on glycolytic flux in a culture of cardiac myocytes? Explain your reasoning?

e. Finally, if molecule 1stAVNGR were infused into a culture of hepatocytes what would be the expected effect on glycolytic flux in these cells? Explain your reasoning.

In: Biology

How do we get from a ligand binding to a heterotrimeric GTP-binding protein to the activation...

How do we get from a ligand binding to a heterotrimeric GTP-binding protein to the activation of PKA?

In: Biology

Research in cell biology and metabolism has progressed due to the discovery of molecules that artificially...

Research in cell biology and metabolism has progressed due to the discovery of molecules that artificially stimulate or inhibit glucagon/epinephrine and insulin signaling pathways. Let’s say you are working in a lab cataloging the effects of a library of small molecules on these pathways and have a “hit” on molecule 1stAVNGR. Preliminary data on molecule 1stAVNGR indicates that the cardiac isoform of PFK2/FBPase2 is doubly phosphorylated when this molecule is present at micromolar concentrations in cell cultures. Given this context answer the following questions.

a. Under these conditions what is the predicted degree of association between the regulatory subunits and the catalytic subunits of PKA?

b. Further investigation of molecule 1stAVNGR indicates elevated levels of cAMP within the cell despite the absence of epinephrine or glucagon. Hypothesize two possible explanations for this data.

c. When cell cultures are given both molecule 1stAVNGR and molecule RedSKLL (a G-protein inhibitor) cAMP levels remain high (again despite the absence of epinephrine or glucagon). Given this new information hypothesize a possible explanation for the data.

In: Biology

1. Which of components of the electron transport chain directly move protons across the inner mitochondrial...

1. Which of components of the electron transport chain directly move protons across the inner mitochondrial membrane?

2. Consider fermentation.
How much ATP is generated during fermentation?

How does the amount of ATP generated by fermentation compare to aerobic respiration?


In humans, why can't fermentation sustain life? (Hint: Think of two reasons—one is related to the product of fermentation and what happens if it accumulates.)

3. Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

In: Biology

Explain how living organisms have changed the atmosphere over Earth’s history.

Explain how living organisms have changed the atmosphere over Earth’s history.

In: Biology

Please explain if you can: In which of the following is the enzyme properly paired with...

Please explain if you can:

In which of the following is the enzyme properly paired with its allosteric inhibitor?

Multiple answers: You can select more than one option

A- hexokinase: glucose-6-phosphate

B- phosphofructokinase: fructose 2 6-bisphosphate

C- pyruvate kinase: alanine

D- glucokinase: glucose-6-phosphate

(I know it is not B, and I know it is definetly A so far. However, I am unsure about the other two. Please provide an explanation if possible.)

In: Biology

Viruses and bacteria share all the following excep

Viruses and bacteria share all the following excep

In: Biology

Sketch, photograph, and submit the schemes and submit the schemes of (1) chromosomal non-disjunction in a...

Sketch, photograph, and submit the schemes and submit the schemes of
(1) chromosomal non-disjunction in a meiosis and (2) fertilization
that would lead to the birth of a child with following genotypes;
indicate all involved genes and chromosomes in parents and the child
a. A Turner syndrome girl with hemophilia
b. A Klinefelter syndrome boy who is heterozygous for color-blindness 2. Respond to 2 of your peers' original posts by commenting on
accuracy and clarity, or suggest edits if you believe they are
needed.

Punnett Squares required

In: Biology

Please answer all the questions, won’t take more than 10 mins What are the characteristics of...

Please answer all the questions, won’t take more than 10 mins

What are the characteristics of living things?
How do the isotopes of a single element differ from each other? Explain with an example.
What are the names and pH values of the strongest acid, and strongest base?
What are the names of Biological Macromolecules.
Give one example of following CARBOHYDRATES;
- Monosaccharide
- Disaccharide
- Polysaccharide
6. What are the subunits (building blocks) of proteins?
7. What are the types of FATTY ACIDS?
8. What is the most important property of phospholipids?
9. What are the names and functions of the organelles of an animal cells?
10. What are the types of transport through plasma membrane?

In: Biology

1 Discuss three ways in which mutations in genetics can be used in agriculture 2 Can...

1 Discuss three ways in which mutations in genetics can be used in agriculture

2 Can genetics in agriculture be solely responsible for global food security?

Include reference and citation

In: Biology

(i) Describe the phenomenon of functional sequence variation using antibodies that can bind to a range...

(i) Describe the phenomenon of functional sequence variation using

antibodies that can bind to a range of different antigens. (ii) Explain the process of domain shuffling in

protein evolution and give an example of how this process can generate proteins with novel functio

In: Biology

Palapye Biotech Company has 10 scientists in the same lab with you. One of the co-workers...

Palapye Biotech Company has 10 scientists in the same lab with you. One of the co-workers who attended another unnamed University in the country got jealous about how technologically advanced you are and decided to get you fired by unscrupulous means. The production strain goes missing. Pheww! You were the last person to visit the collections storeroom as witnessed by the collections storeroom logbook. You are then entrusted to do the investigation of the theft of the company´s novel production strain. During the investigation you acquire the following evidence; • A spot of blood on the corners of the tables in the store room suggesting that the suspect probably got injured in the haste ordeal • Hair follicles • Used gloves worn probably by the suspect to get the samples from the freezer vii. Your advisor suggests that you can use your molecular biology skills to identify the suspect, by using the serological tests. How will you argue (progressively) that the technology will not resolve the issue (2).

In: Biology

In Diet and Wellness Ruben Ward Profile 2000 calorie menu fom my plate intake bs goals....

In Diet and Wellness Ruben Ward Profile 2000 calorie menu fom my plate intake bs goals. Daye of Birth May 7th 1998 19yrs old.

In: Biology

24. Put the following events in chronological order (oldest to most recent): (1) Gorilla and Pan...

24. Put the following events in chronological order (oldest to most recent):

(1) Gorilla and Pan share a common ancestor.

(2) Homo and Pan share a common ancestor.

(3) hominins become bipedal.

(4) the onset of the Pleistocene epoch

a.   1,3,2,4

b.   1,2,3,4

c.    2,1,3,4

d.    2,1,4,3

e.   None of the above.

In: Biology

What are some of ways that allow coral reef and antarctic reef fishes to maintain a...

What are some of ways that allow coral reef and antarctic reef fishes to maintain a similar "pace of life"?

In: Biology