1. Describe the principles behind and the applications of the following:

a) Southern blotting

b) cDNA synthesis

c) CRISPR-Cas9 gene editing

d) S1 Mapping or Primer Extension

e) Sanger Sequencing of DNA

f) Site-directed mutagenesis

j) cDNA cloning

k) Western Blotting

l) Restriction Enzymes

please answer them all because its including in one question !

write an Impact Statement on water resources and how to get drinkable water to everyone worldwide How will your use of science and technology impact a people group with this problem? (~1-2 Pages) 7. State the problem. 8. State the technology and science you intend to use to solve the problem. 9. Introduce the people group affected by the problem. 10. Describe what has been done to improve the problem and the impact it has had on the people group. 11. Describe a range of possible (technology and science) solutions to the problem. Detail possible affects on the people group if these solutions are utilized. 12. Conclusion

Can you suggest where the coding sequence might occur iwthin this sigment? What is your evidence?

It ask me to use Needleman-Wunsch algorithm to compare two sequence.

sequence 1

AGCAAAAGCAGGGGATAATAAAAACAACCAGAATGAAAGTAAAACTACTGGTCCTGTTATGCACATTTAC
AGCTACATATGCAGACACAATATGTATAGGCTACCATGCTAACAACTCGACCGACACTGTTGACACAGTA
CTTGAAAAGAATGTGACAGTGACACACTCTGTCAACCTGCTTGAGAACAGTCACAATGGAAAACTATGTC
TATTAAAAGGAATAGCCCCACTACAATTGGGTAATTGCAGCGTTGCCGGGTGGATCTTAGGAAACCCAGA
ATGCGAATTACTGATTTCCAAGGAGTCATGGTCCTACATTGTAGAAAAACCAAATCCTGAGAATGGAACA
TGTTACCCAGGGCATTTCGCTGACTATGAGGAACTGAGGGAGCAATTGAGTTCAGTATCTTCATTTGAGA
GGTTCGAAATATTCCCCAAAGAAAGCTCATGGCCCAACCACACCGTAACCGGAGTGTCAGCATCATGCTC
CCATAATGGGGAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGGGGAAGAATGGTTTGTACCCAAAC
CTGAGCAAGTCCTATGCAAACAACAAAGAAAAAGAAGTCCTTGTACTATGGGGTGTTCATCACCCGCCAA
ACATAGGTATCCAAAAGGCCCTCTATCATACAGAAAATGCTTATGTCTCTGTAGTGTCTTCACATTATAG
CAGAAAATTCACCCCAGAAATAGCCAAAAGACCCAAAGTAAGAGATCAAGAAGGAAGAATCAATTACTAC
TGGACTCTGCTTGAACCCGGGGATACAATAATATTTGAGGCAAATGGAAATCTAATAGCGCCAAGATATG
CTTTCGCACTGAGTAGAGGCTTTGGATCAGGAATCATCAACTCAAATGCACCAATGGATAAATGTGATGC
GAAGTGCCAAACACCTCAGGGAGCTATAAACAGCAGTCTTCCTTTCCAGAACGTACACCCAGTCACAATA
GGAGAGTGTCCAAAGTATGTCAGGAGTGCAAAATTAAGGATGGTTACAGGACTAAGGAACATCCCATCCA
TTCAATCCAGAGGTTTGTTTGGAGCCATTGCCGGTTTCATTGAAGGGGGGTGGACTGGAATGGTAGATGG
TTGGTATGGTTATCATCATCAGAATGAGCAAGGATCTGGCTATGCTGCAGATCAAAAAAGCACACAAAAT
GCCATTAATGGGATTACAAACAAGGTGAATTCTGTAATTGAGAAAATGAACACTCAATTCACAGCTGTGG
GCAAAGAATTCAACAAATTGGAAAGAAGGATGGAAAACTTGAATAAAAAAGTTGATGATGGGTTTATAGA
CATTTGGACATATAATGCAGAACTGTTGGTTCTACTGGAAAATGAAAGGACTTTGGATTTCCATGACTCC
AATGTGAAGAATCTGTATGAGAAAGTAAAAAGCCAGTTAAAGAATAATGCTAAAGAAATAGGAAATGGGT
GTTTTGAATTCTATCACAAGTGTAACGATGAATGCATGGAGAGTGTAAAGAATGGAACTTATGACTATCC
AAAATATTCCGAAGAATCAAAGTTAAACAGGGAGAAAATTGATGGAGTGAAATTGGAATCAATGGGAGTC
TATCAGATTCTGGCGATCTACTCAACAGTCGCCAGTTCTCTGGTTCTTTTGGTCTCCCTGGGGGCAATCA
GCTTCTGGATGTGTTCCAATGGGTCTTTACAGTGTAGAATATGCATCTAAGACCAGAATTTCAGAAATAT
AAGGAAAAACACCCTTGTTTCTACTA

sequence 2

ATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTT
ATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGT
TAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGT
AAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGT
CCTACATTGTGGAAACACCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGA
GCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGG
CCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAA
ATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGG
GAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAG
AATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAA
GACCCAAAGTGAGGGRTCRAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAAT
AACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCT
GGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAAACACCCAAGGGTGCTATAA
ACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCAC
AAAATTGAGACTGGCCACAGGATTGAGGAATATCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATT
GCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGC
AGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAA
TTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGA
ATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGG
TTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAG
AAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAAC
ACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACA
GAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGT
CGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTA
CAGTGTAGAATATGTATTTAA

What are the differences between embryonic stem cells and oocytes?

Describe SSO, SSP, and SBT test methods that can be performed to determine HLA type?

LaTeisha was finally headed back from Nigeria! This trip had been transformational but she was also

glad to head back home to hot showers, familiar food, and a routine including her own car. Two weeks in

the rural countryside is a lot.... Abuja was her new favorite city! Her church had told them all about the

amazing work the medical missionaries did and she already had her CNA so why not? It would be a great

experience and look good on her application to PA school.

And it was incredible... she helped administer vaccines, culture strep throat, detect atypical pneumonia in

coughing children, just amazing. She was impressed by the resilience of the Nigerian villagers; they were

struggling with drought, the cows were spontaneously aborting the calves, and militias visited from the

north all too often but they quietly persevering all the same. . The villagers inspired her and she knew it

was international medicine she was destined to do for her whole life.

But now, just the morning after her flight landed in Atlanta, she wasn’t feeling so well. She felt it a little

on the plane but that could have just been her fear of lying. She was pretty sure she had a fever now. She

felt kinda achy too – knees and elbows and neck. Not so fun. She still had a week before school so she

could just be lazy and recover. She slept the day away.

The next day, things were worse. Her mom insisted she call a doctor. She was vomiting now and it was...

black. Her mom also said that her eyes looked funny, yellowish. They went to an urgent care clinic near

their house. As the PA on duty, you take her case history, temperature, blood and stool samples. Her

really low blood pressure and the color of the vomit were serious indicators

4.

The pathogen causing

LaTeisha’s illness is _______

5.

This organism is severely damaging LaTeisha’s body. How does it cause damage and what isONE virulence factor

In Photosynthesis, what do you think would happen if no hydrogen ion gradient could be established between the inside of the thylakoid (thylakoid lumen) and the outside of the thylakoid. How would this affect ATP production? *minimum 250 words

In some plants a red pigment is synthesized from a colorless precursor by a single enzyme coded for by gene A. The red pigment can be changed into a purple pigment by another enzyme coded for by gene B. A cross between pure-breeding purple plants and white plants with the resulting F₂:

94 purple

31 red

43 white

A. Give a concise genetic hypothesis for inheritance of flower color from these results (include number of genes, number of alleles, and the relations between genes and alleles).

B. Using symbols A and B to correspond to genes A and B as described above symbolize the genotypes and their ratios for each F₂ phenotypic class.

C. If the F₁ is used in a testcross, what phenotypic ratio would you expect in the progeny?

In a unique species of plants, flowers may be either yellow, blue, red, or mauve. A pure-breeding line with blue flowers is crossed to a pure-breeding red-flowered line, and the resulting F₁ plants have yellow flowers. In the F₂ the following ratio is observed:

9/16 yellow: 3/16 blue: 3/16 red: 1/16 mauve

If pure-breeding yellow and mauve plants are crossed, the same F₂ ratio is observed.

A. Give a concise genetic hypothesis for the inheritance of this trait (include number of genes, number of alleles and dominance relations between alleles).

B. Designate your own gene symbols and list the genotypes and ratios for each F₂ class.

C. Determine the expected phenotypic ratios if the F₁ from above is crossed to a pure-breeding mauve plant.

A bacterial strain called XYZ living in the lake MBG223 near Bilkent University requires to synthesize tryptophan continuously.  The reason is, the essential proteins (essential means, the proteins required for survival of the bacteria) contain high content of tryptophan.  Therefore, this bacterial strain XYZ has a tryptophan operon.  Unfortunately, the tryptophan level of nutrition available in lake MBG223 is very limited during summer and winter time and the other nutrition levels are high. During the summer time, as the lake MBG223 partially evaporates, the salinity of the water increases, the temperature of the lake arises and the pH of the environment turns from natural to acidic.  Changes in salinity, pH and temperature is known to disrupt hydrogen bonding in nucleotide base-pairings and also the structure of the proteins.  Here, assuming that the structure/function of the proteins are not effected please answer the followings.

a) İnside the XYZ bacteria, what would you observe with regards to synthesis of tryptophan bearing proteins during summer vs. winter time?  How would this effect bacterial growth rate during the summer time vs winter time? (18pts)

b) In another neighboring lake called MBG222, they found a different bacterial strain called WOWWW to have mutant tRNAs on the anti-codon region of the tRNA.  This tRNA carries Phenylalanine to wherever it encounters the sequence UGG (tryptophan) on the mRNA. What happens to the regulation of the trypthophan operon in bacteria that has 1) high tryptophan and low phenylalanine vs. bacteria that has low tryptophan and high phenylalanine? (12 pts)

Please emphasize if the following are cis-acting, trans-acting or both on the lac operon.

The lac repressor Protein:
The Operator sequence:
The Operon sequence:
RNA Polymerase II

Give a 4 sentence summary of this discussion (below) thanks!

Title:
Development of an Adhesion Assay and Characterization of an Adhesion-Deficient Mutant of Pseudomonas fluorescens

DISCUSSION: The reproducibility of the adhesion data obtained in the sand column assay indicates that the assay can distinguish between strains which adhere differentially to an inert matrix. Soil pseudomonads and two E. coli strains demonstrated a wide range of adhesive abilities. All soil isolates adhered in higher percentages than the enteric strains. Although use of soil as the column matrix would have been more similar to the environment from which these strains were isolated, we found that soil columns filtered rather than measured adhesion -of the bacteria. This feature of soil columns may partially explain results of others who studied soil adsorption of Azospirillum brasilense and recovered no cells from washed soil columns (2). In this work, however, A. brasilense applied to a sand column did not adhere and was almost completely removed by the wash procedure. In contrast, P. fluorescens in our assay remained attached to the sand column despite repeated washes. This result indicates a relatively strong mechanism of adhesion by these pseudomonads. In optimizing the assay, we found that logarithmically growing cells adhered in higher percentages than stationaryphase cultures.-However, minimal medium was a better growth medium for attachment than was L broth. These findings suggest that growth phase and nutrient state affect the attachment potential of these cells. Moreovei, adhesion was best if cells were washed free of growth medium before inoculation. These results agree with previous reports that bacterial attachment to surfaces is one response to conditions of nutrient limitation (18, 21). Similar findings have been reported for marine bacteria (11, 15). Logarithmically growing marine pseudomonads adhered to polystyrene better than those in the stationary phase (15), and vibrios inoculated in salt solution rather than rich medium adhered more readily (11). Increasing the ionic strength of a suspending buffer also decreases the electrostatic repulsion between two surfaces of like charge. If both the bacterial cell and the attachment surface are negatively charged, purely on the basis of physicochemical properties, increasing ionic strength should increase adhesion (30). In our assay, however, increasing the salt concentration in either the buffer in which the cells were added or in the wash buffer did not significantly affect adhesion. These results suggest that electrostatic repulsion is not important in adhesion of PfO-1 to sand. VOL. 56, 1990 118 DEFLAUN ET AL. The design of the assay allowed us to screen thousands of mutants and to identify Tn5-induced chromosomal mutations in P. fluorescens which caused reduced ability to adhere to sand. Preliminary evidence suggests that this screening process is also efficient for P. putida soil isolates, although an adhesion mutant has not been verified from this group (unpublished data). The adhesion deficiency phenotype suggested an alteration in the cell surface. This was confirmed by membrane protein profiles. A 34-kDa major protein in the outer membrane of the wild-type Pf0-1 strain and in the TnS mutants which retain wild-type adhesion ability was missing in PfO-5. Preliminary studies of the second adhesion-deficient PfO-1::TnS mutant, PfO-10, indicate that although Tn5 is located at a different site on the chromosome, it lacks the same 34-kDa outer membrane protein as PfO-5. This is additional evidence that this protein is important for adhesion in this strain. Transmission electron microscopy and protein purification identified the wild-type protein as flagellin. Although pili or fimbrial structures are more commonly associated with bacterial adhesion, flagella have been implicated in the adhesive abilities of certain Vibrio strains (1, 4). Adhesion of P. fluorescens to a soil amoeba has also been attributed to polar flagella as revealed by light microscopy. Electron microscopy suggested that this attachment was not confined to the flagellar tip but involved other surfaces of these appendages (26). Flagella of P. fluorescens were found to be essential for colonization of potato roots; this was attributed to lack of motility in flagellumless mutants (12). Our findings are the first to link a defined mutation site with the absence of this motility structure in P. fluorescens and reduced adhesion to an inert surface such as sand. The molecular weight of the flagellum protein in P. fluorescens seems to vary with the strain. The flagella from a P. fluorescens isolate from potato roots which were purified by the same method that we used had a molecular mass of 58 kDa on a polyacrylamide gel (12), which is much larger than the 34-kDa molecular mass that we found for our purified flagellin. An approximate molecular weight obtained by sedimentation coefficients for P. fluorescens flagella was 38 kDa, although this was thought to be an underestimate (31). Antisera produced against this purified flagellin did not react with the flagella or flagellin of all of the P. fluorescens strains tested, indicating that there are indeed subspecies differences in flagella (31). The residual adhesive ability of PfO-5 (40 to 50%), which adhered at a higher percentage than the E. coli strains tested (8 to 22%), indicates that other proteins may be responsible for attachment. Although PfO-5 does not have flagella, such adhesins may still be present on the cell surface and account for the residual attachment observed in this strain. Linkage between the Tn5 insertion and the adhesiondeficient phenotype of PfO-5 was demonstrated by the marker exchange technique. Placement of TnS into the same chromosomal site in unmutated strain PfO-1 caused the adhesion deficiency phenotype of Pf0-5. The TnS marker thus affords a means for identifying and cloning the gene(s) responsible for flagellar synthesis and understanding its role in adhesion.

ACKNOWLEDGMENTS This work was supported by grant BSR 8606657 from the National Science Foundation. We appreciate the technical assistance of Judith Reichler, who performed the electron microscopy, and we thank Blaine Metting for careful reading of the manuscript.

giving relevant agricultural examples, what are the three main ways that microorganisms affect our food supply?

For each E coli genotype and condition in the following table, choose which sets of functional proteins will or will not be produced.

All grown in media with no/low glucose.

I^S indicates a super-repressor (it can’t bind to lactose/inducers).

O^C indicates a constitutive operon (no repressor can bind to this region of DNA).

I^- ; Z^- ; Y^-each indicate an allele that does not produce a functional protein.

P^- indicates a mutation in the promoter region such that RNA polymerase does not bind.