Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'

Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'

Design a splint oligomer and write the all-possible content(s) needed for reaction to occur.

For the last several years scientists have fretted over the future of bees, and although research has shed much light on the crisis, there is still debate on the causes and costs of this issue. In no more than 500 words state your opinion on this topic.

Please illustrate the steps to recombinant cloning of the vector to express c-Myc-GFP-His6 in mammalian cells with detailed DNA sequences of primers. Please explain why the chosen particular vector was used and why the chosen version of the c-Myc gene was used.

Arthropods represent the cumulation of evolutionary development in the protostomes. identify at least three characteristics that contribute to their success. and explain the selective advantage of each exmaple.

The question can be answered in a variety of ways. You are encouraged (and in some case required) to use graphs and diagrams as part of your answer, to illustrate your argument or particular concept. This question requires a discussion of vertebrate cardiovascular system other than human.

The vertebrate cardiovascular (CV) system has a job of delivering a variety of molecules, entrained in plasma, to all the cells in your body. How does it achieve this function effectively (at sufficient rate) and efficiently (with minimal energetic cost)? How does the transport & transfer function differ in extant endotherms and ectotherms? Among vertebrates there's a wealth of circulatory designs, each of which must perform the transport/transfer function. Human CV system is similar only to that of other mammals (and birds, to some extent), but why would you leave out other vertebrates? How do their CV systems work? How good are they at transport? What are the constraints in different CV systems? So much to write about... This discussion should involve different cardiovascular systems.

1. What happens if one solute can pass through the membrane, but another cannot?

2. How do semi-permeable membranes and the processes of diffusion and osmosis contribute to homeostasis in cells?

1- A shallow cut into the trunk of a young tree will often result in the death of any branches above that cut. Explain why this happens

2-On many Ontario highways a plant known as crown vetch is often planted on slopes on the side of the highway. These plants are so important that signs identify them and warn against cutting. A study of the plant shows an extensive root system. Why is this plant grown on embankments?

Health literacy is a growing problem in the United States. How does health literacy impact the ability to conduct epidemiological studies and to improve health?

an isolated population of cats are observed for their frequency in an allele for striped and spotted coloring as well as the actual level of heterozygosity in each population. Allele frequency for stripes is 0.62 and spots 0.38, The observed frequency of heterozygotes is 0.08 What is the inbreeding coefficient of this population? is the population undergoing inbreeding based off of the inbreeding coefficient.

Devise a restriction analysis method to confirm the desired recombinant; use a single most appropriate enzyme. Calculate the expected sizes of the restriction fragments from each, the vector and the desired recombinant

1. How many oxidation steps take place in glycolysis per glucose molecule? How many phosphorylation steps per glucose molecule?

2. What is the net number of ATP molecules produced per glucose molecule during glycolysis? These ATP molecules are synthesized using which of the phosphorylation mechanisms: substrate level phosphorylation, or oxidative phosphorylation?

1. Which organism is easier to grow in the laboratory, E. coli, or Neisseriae gonorrhea?

2. Describe the growth of E. coli in (on) soft agar.

Explain why any functional impairment of PDC, TCA cycle and ETC/oxidative phosphorylation can cause lactic acidosis.