Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

Can you find any mutation, name the domains, if the proteins are conserved, and the amino acid sequences and in which organelle will you find the genetic material that encodes your genes.

>Pseudo-nitzschia multiseries (the homolog of the osteroccus tauri)

ATGTCTCAATCTGTATCAGAACGGACTCGAATTAAAAGTGACCGTTACGAATCTGGTGTAATCCCTTACG

CTAAAATGGGTTACTGGGATGCTTCATACACAGTAAAAACTACTGATGTTCTTGCTTTATTCCGTATCAC

ACCACAACCAGGCGTAGATCCTGTTGAAGCTGCTGCTGCAGTAGCTGGTGAATCTTCAACAGCAACTTGG

ACAGTTGTATGGACTGATTTATTAACAGCTTGTGATCGTTACCGAGCTAAAGCTTACCGTGTAGATCCAG

TTCCAAATACATCTGATGTTTTCTTTGCTTTCATCGCATACGAATGTGATTTATTCGAAGAAGGTTCTTT

ATCTAACTTAACAGCATCTATTATTGGTAACGTATTCGGTTTCAAAGCTGTATCAGCTTTACGTTTAGAA

GACATGCGTATTCCTCACTCATACTTAAAAACATTCCAAGGTCCTGCAACAGGTATCGTTGTAGAACGTG

AACGTTTAAATAAATATGGTGCTCCTTTATTAGGTGCTACAGTAAAACCAAAATTAGGTTTATCTGGTAA

AAACTACGGTCGTGTAGTATTCGAAGGTTTAAAAGGTGGTTTAGACTTCTTAAAAGATGATGAGAACATT

AACTCTCAACCATTCATGCGTTGGAGAGAGCGTTTCTTAAACTGTATGGAAGGTATTAACCGTGCATCTG

CTGCTACAGGAGAAGTAAAAGGTTCTTACTTAAACGTTACAGCTGCTACTATGGAAGAAGTAATCAAACG

TTGTGAGTACGCTAAAGAAGTAGGTTCTGTTATCGTTATGATCGATTTAGTTATGGGTTATACAGCTATT

CAATCTGCTGCTTACTGGGCTCGTGAAAACGATATGCTTTTACACTTACACCGTGCTGGTAACTCTACAT

ATGCACGTCAAAAAAACCATGGTATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCTGGTGTAGA

TCATATCCACGCTGGAACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTACGAT

ACTTTACGTTTAACTCATTTAGAAGTTAATTTACCATACGGTATTTTCTTCGAAATGCCTTGGGCTAGTT

TACGTCGTTGTATGCCAGTAGCATCTGGTGGTATTCACTGTGGTCAAATGCACCAATTAATTCACTACTT

AGGTGATGACGTAGTATTACAATTCGGTGGTGGTACAATTGGTCACCCTGATGGTATCCAAGCCGGTGCT

ACAGCTAACCGTGTTGCTTTAGAAGCAATGGTATTAGCTCGTAACGAAGGTGCTGATTTCTTCAGTAACG

AAGTTGGTCCTCAAATCTTACGTAATGCTGCTAAAACATGTGGTCCATTACAAACTGCATTAGATTTATG

GAAAGATATTAGTTTTAACTACACATCTACAGATACAGCTGATTTCGCTGTAACACCAACTGCAAACGTA

TAA

Does glucose-6-phosphate allosterically inhibit glucokinase AT ALL?

Discuss the impact of public (government) and private controls on long term care.

Briefly describe an infectious disease and how it affects a human host.

To study genetic variations (i.e. mutations) between species, especially highly divergent species like insects and mammals, what type of genetic regions or genes have to be used? Give two examples​

An adult male, 150 pounds, consumes water contaminated with 1 milligrams of DDT per liter for three years at a rate of two liters per day. Assuming the man does not receive any does of DDT other than this, by how much is this amount (the average daily intake accumulated in those three years) above the life-time safety exposure limit of 0.02mg/kg body weight?

Also, given this scenario would the ADI life-time safety exposure limit be an appropriate measure of this man's risk? Why or why not?

Research in cell biology and metabolism has progressed due to the discovery of molecules that artificially stimulate or inhibit glucagon/epinephrine and insulin signaling pathways. Let’s say you are working in a lab cataloging the effects of a library of small molecules on these pathways and have a “hit” on molecule 1stAVNGR. Preliminary data on molecule 1stAVNGR indicates that the cardiac isoform of PFK2/FBPase2 is doubly phosphorylated when this molecule is present at micromolar concentrations in cell cultures. Given this context answer the following questions.

a. Under these conditions what is the predicted degree of association between the regulatory subunits and the catalytic subunits of PKA?

b. Further investigation of molecule 1stAVNGR indicates elevated levels of cAMP within the cell despite the absence of epinephrine or glucagon. Hypothesize two possible explanations for this data.

c. When cell cultures are given both molecule 1stAVNGR and molecule RedSKLL (a G-protein inhibitor) cAMP levels remain high (again despite the absence of epinephrine or glucagon). Given this new information hypothesize a possible explanation for the data.

d. In consideration of the data presented in this problem what would be the expected effect of molecule 1stAVNGR on glycolytic flux in a culture of cardiac myocytes? Explain your reasoning?

e. Finally, if molecule 1stAVNGR were infused into a culture of hepatocytes what would be the expected effect on glycolytic flux in these cells? Explain your reasoning.

How do we get from a ligand binding to a heterotrimeric GTP-binding protein to the activation of PKA?

Research in cell biology and metabolism has progressed due to the discovery of molecules that artificially stimulate or inhibit glucagon/epinephrine and insulin signaling pathways. Let’s say you are working in a lab cataloging the effects of a library of small molecules on these pathways and have a “hit” on molecule 1stAVNGR. Preliminary data on molecule 1stAVNGR indicates that the cardiac isoform of PFK2/FBPase2 is doubly phosphorylated when this molecule is present at micromolar concentrations in cell cultures. Given this context answer the following questions.

a. Under these conditions what is the predicted degree of association between the regulatory subunits and the catalytic subunits of PKA?

b. Further investigation of molecule 1stAVNGR indicates elevated levels of cAMP within the cell despite the absence of epinephrine or glucagon. Hypothesize two possible explanations for this data.

c. When cell cultures are given both molecule 1stAVNGR and molecule RedSKLL (a G-protein inhibitor) cAMP levels remain high (again despite the absence of epinephrine or glucagon). Given this new information hypothesize a possible explanation for the data.

1. Which of components of the electron transport chain directly move protons across the inner mitochondrial membrane?

2. Consider fermentation.
How much ATP is generated during fermentation?

How does the amount of ATP generated by fermentation compare to aerobic respiration?


In humans, why can't fermentation sustain life? (Hint: Think of two reasons—one is related to the product of fermentation and what happens if it accumulates.)

3. Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

Explain how living organisms have changed the atmosphere over Earth’s history.

Please explain if you can:

In which of the following is the enzyme properly paired with its allosteric inhibitor?

Multiple answers: You can select more than one option

A- hexokinase: glucose-6-phosphate

B- phosphofructokinase: fructose 2 6-bisphosphate

C- pyruvate kinase: alanine

D- glucokinase: glucose-6-phosphate

(I know it is not B, and I know it is definetly A so far. However, I am unsure about the other two. Please provide an explanation if possible.)