1. What differences do you observe between the fern life-cycle, and the moss lifecycle?
2. Describe the fern sporophyte. Does this part of the plant have haploid or diploid cells? What function is served by this part of the fern plant’s lifecycle?
3. Describe the fern gametophyte. Does this part of the plant have haploid or diploid cells? What function is served by this part of the fern plant’s lifecycle?
4. What are the major defining characteristics that distinguish the True Mosses from the Club Mosses
In: Biology
In: Biology
Do Enzymes in the digestive tract catalyze hydrolysis reactions.
In: Biology
Draw a diagram in which Nature and Nurture appear at opposite ends of a continuum. Come up with 10 traits that you can place at various locations along this continuum. So, you should have at least some traits that you believe are very (or maybe completely) influenced by genetic factors, and some traits that are similarly influenced by the environment, AND several traits that are a mishmash of these to varying degrees.
In: Biology
Name the appendages found on the abdomen of the crayfish. How can you identify the sex of the specimen by examining these appendages? What special use do they have in the female?
In: Biology
Explain why a control tube with a nonmotile bacterial species is necessary for reliable determination of bacterial motility by a) the hang drop preparation and b) the motility test agar preparation.
In: Biology
Both alcohol and caffeine affect the neurological system. Although alcohol is a controlled substance, caffeine is not. Develop an argument to make caffeine (coffee and other caffeinated beverages) a controlled substance.
In: Biology
Microbiology
Meningitis Case Study #3
Patient A: A 73-year-old Guatemalan man named Francisco Salazar was brought into the ER by his daughter with a chief complaint of a 5-day history of fever, back and neck pain, headache, and confusion. Francisco’s daughter notes that they live on a dairy farm and he has a history of cirrhosis and non-insulin dependent diabetes. A lumbar puncture was performed for cerebrospinal fluid (CSF) analysis.
Patient B: Alice Chen, a 6-year-old female, presented to the emergency department with a 4-day history of worsening headache and a rash on her trunk. Her mother mentioned that over-the-counter medications had no effect on her headache. Alice mentioned that the bright lights of the examination room hurt her eyes and she stated that her “head hurts all over.” She also had difficulty trying to move her neck. A physical test revealed some vesicular lesions on her hands and feet. A lumbar puncture was also performed for cerebrospinal fluid analysis.
Normal CSF ranges |
Patient #A |
Patient #B |
|
Leukocytes (per mm3) |
1145 |
115 |
|
% Neutrophils |
70 |
30 |
|
Glucose (mg/dL) |
20 |
54 |
|
Protein (mg/dL) |
410 |
53 |
Patient A has Bacterial Meningitis
Patient B has Viral Meningitis
What specific disease do they have, how do you treat it, and what is the prognosis
In: Biology
What is the key difference between financial statement analysis and operating indicator analysis? How are these types of analyses useful to healthcare managers and investors? Consider a healthcare organization with which you are familiar and discuss what are some of the problems or challenges inherent in financial statement analysis?
In: Biology
The genome of herpes-type viruses is linear double-stranded DNA. Acyclovir is an agent antiviral that inhibits DNA replication in cells infected by this virus. It is administered to patients in dephosphorylated form although it acts only after it is modified by phosphorylation.
a) Propose a possible mechanism of inhibition of replication. b) Acyclovir has very few side effects because it is only modified in cells infected. Explain. c) Herpes virus can become insensitive to acyclovir therapy by mutations in two genes. Discuss what those genes might be.
In: Biology
Describe the general flew of lymph from lymphatic capillaries through return to three circulatory system. Include relevant structures and functional aspects of this journey.
In: Biology
What do I do for this? I am confused in what to do.
Choose a developmental domain covered in Module 2 (motor, self-care, cognitive). Provide a rationale for why development in this area is important for overall child development. Provide three strategies you would recommend caregivers implement at home to advance their childrens' skills in the chosen developmental domain.I chose the Self-Care domain.
In: Biology
4. How many mutations and other sequence variants have been reported in dbSNP for human CFTR?
[please be detailed, thanks]
In: Biology
1. What are the k-mers of length k = 21 for this sequence read in FASTQ format?
@K000384:75:HM57CBBXX:1:1101:25530:1384 1:N:0:GTGGCC
CTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT
+
AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
[please be detailed, thanks]
In: Biology
Question 8. A transmembrane protein uses a β barrel structure to span the cell membrane. How can amino acid mutations in a protein within this β barrel structure affect interactions with the membrane and why? (Up to 50 words)
Question 9. Haemoglobin is a protein that carries oxygen in our red blood cells. Sickle cell anaemia is a genetic disease in which Glu at position 6 of haemoglobin is mutated to a Val, rendering haemoglobin non-functional.
Question 10. Lectin is a protein that binds carbohydrates and is critical for biological recognition processes in living organisms. Describe what bonds and forces could be involved in lectin and carbohydrate interactions. (Up to 50 words)
Question 11. A hexokinase is an enzyme that adds a phosphate to glucose after it enters the cell, which is considered the first step of glycolysis. One enzyme, hexokinase A (HKA), has a Km of 0.02 mM, whereas another, hexokinase B (HKB), has a Km of 1.0 mM. Explain why some types of fast growing cancer cells would use HKA instead of HKB. (Up to 50 words)
In: Biology