What is meant by the term cluster of differentiation and give its importance in immune response?
In: Biology
Discuss how natural selection has likely influenced the evolution of skin color in humans
In: Biology
Marine Biology Question: What is an Aternative Stable State?
In: Biology
The production of the mature female gametophyte (embryo sac) via the process of megagametogenesis is unique to Angiosperms.
The process of double fertilization is also a defining Angiosperm characteristic. Describe double fertilization that occurs in the mature embryo sac and indicate the results of such fertilization .
And finally, name and describe two advantages that the Angiosperms enjoy over the Gymnosperms (and everyone else) that has allowed them to conquer the plant world! (2@5 marks each).
In: Biology
In: Biology
what purpose does the female gametophyte serve in the gymnosperm seed?
In: Biology
In a thalassemia (blood disease) prevalent in Southeast Asia, the hemoglobin A polypeptide chain is longer than normal, although the mRNA length is unchanged. The normal HbA polypeptide ends with the sequence: – Lys – Tyr – Arg –(C terminus). The mutant version adds 30 amino acids, ending with: – Lys – Tyr – Arg – Gln – (29 more amino acids) –(C terminus). The causative mutation in the HbA gene is most likely:
A. a transition mutation.
B. a transversion mutation.
C. a nonsense mutation.
D. a frameshift mutation.
E. an insertion mutation
Make sure provide the best explanation about your answer by explaining what the question is asking first and then falsify (provide explanation) each of the choices you did not choose. Ultimately, also provide explanation for for the correct choice. Define any key concepts and terms along the way and make diagrams if necessary to provide the best explanation.
In: Biology
As you showed on the last exam, an experiment at U of Arkansas a couple of years ago showed that the genes for CHF and RA are linked by a distance of 10.2 cM in pigs. In order to test the linkage relationship obtained by the U of Arkansas team, a U of Missouri biology team repeated the experiment making exactly the same cross, but using independently obtained pigs.
Healthy pigs: 255
CHF: 40
RA: 44
Both CHF & RA: 261
Total: 600
Conduct a chi2 test to ascertain if there is sufficient grounds for the Missouri team to reject the Arkansas linkage value. Hint: For your expected values, use the linkage estimate provided by the Arkansas researchers to calculate what the Missouri team would have expected in their experiment. Be sure to show how you calculated your X2 value, your d.f., p-value, and conclusion from your test. For expected values use to 1 decimal, for X2 values use to 2 decimals. If you reject the Arkansas hypothesis, propose an alternative explanation
In: Biology
In: Biology
1. Describe the principles behind and the applications of the following:
a) Southern blotting
b) cDNA synthesis
c) CRISPR-Cas9 gene editing
d) S1 Mapping or Primer Extension
e) Sanger Sequencing of DNA
f) Site-directed mutagenesis
j) cDNA cloning
k) Western Blotting
l) Restriction Enzymes
please answer them all because its including in one question !
In: Biology
write an Impact Statement on water resources and how to get drinkable water to everyone worldwide How will your use of science and technology impact a people group with this problem? (~1-2 Pages) 7. State the problem. 8. State the technology and science you intend to use to solve the problem. 9. Introduce the people group affected by the problem. 10. Describe what has been done to improve the problem and the impact it has had on the people group. 11. Describe a range of possible (technology and science) solutions to the problem. Detail possible affects on the people group if these solutions are utilized. 12. Conclusion
In: Biology
Can you suggest where the coding sequence might occur iwthin this sigment? What is your evidence?
It ask me to use Needleman-Wunsch algorithm to compare two sequence.
sequence 1
AGCAAAAGCAGGGGATAATAAAAACAACCAGAATGAAAGTAAAACTACTGGTCCTGTTATGCACATTTAC
AGCTACATATGCAGACACAATATGTATAGGCTACCATGCTAACAACTCGACCGACACTGTTGACACAGTA
CTTGAAAAGAATGTGACAGTGACACACTCTGTCAACCTGCTTGAGAACAGTCACAATGGAAAACTATGTC
TATTAAAAGGAATAGCCCCACTACAATTGGGTAATTGCAGCGTTGCCGGGTGGATCTTAGGAAACCCAGA
ATGCGAATTACTGATTTCCAAGGAGTCATGGTCCTACATTGTAGAAAAACCAAATCCTGAGAATGGAACA
TGTTACCCAGGGCATTTCGCTGACTATGAGGAACTGAGGGAGCAATTGAGTTCAGTATCTTCATTTGAGA
GGTTCGAAATATTCCCCAAAGAAAGCTCATGGCCCAACCACACCGTAACCGGAGTGTCAGCATCATGCTC
CCATAATGGGGAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGGGGAAGAATGGTTTGTACCCAAAC
CTGAGCAAGTCCTATGCAAACAACAAAGAAAAAGAAGTCCTTGTACTATGGGGTGTTCATCACCCGCCAA
ACATAGGTATCCAAAAGGCCCTCTATCATACAGAAAATGCTTATGTCTCTGTAGTGTCTTCACATTATAG
CAGAAAATTCACCCCAGAAATAGCCAAAAGACCCAAAGTAAGAGATCAAGAAGGAAGAATCAATTACTAC
TGGACTCTGCTTGAACCCGGGGATACAATAATATTTGAGGCAAATGGAAATCTAATAGCGCCAAGATATG
CTTTCGCACTGAGTAGAGGCTTTGGATCAGGAATCATCAACTCAAATGCACCAATGGATAAATGTGATGC
GAAGTGCCAAACACCTCAGGGAGCTATAAACAGCAGTCTTCCTTTCCAGAACGTACACCCAGTCACAATA
GGAGAGTGTCCAAAGTATGTCAGGAGTGCAAAATTAAGGATGGTTACAGGACTAAGGAACATCCCATCCA
TTCAATCCAGAGGTTTGTTTGGAGCCATTGCCGGTTTCATTGAAGGGGGGTGGACTGGAATGGTAGATGG
TTGGTATGGTTATCATCATCAGAATGAGCAAGGATCTGGCTATGCTGCAGATCAAAAAAGCACACAAAAT
GCCATTAATGGGATTACAAACAAGGTGAATTCTGTAATTGAGAAAATGAACACTCAATTCACAGCTGTGG
GCAAAGAATTCAACAAATTGGAAAGAAGGATGGAAAACTTGAATAAAAAAGTTGATGATGGGTTTATAGA
CATTTGGACATATAATGCAGAACTGTTGGTTCTACTGGAAAATGAAAGGACTTTGGATTTCCATGACTCC
AATGTGAAGAATCTGTATGAGAAAGTAAAAAGCCAGTTAAAGAATAATGCTAAAGAAATAGGAAATGGGT
GTTTTGAATTCTATCACAAGTGTAACGATGAATGCATGGAGAGTGTAAAGAATGGAACTTATGACTATCC
AAAATATTCCGAAGAATCAAAGTTAAACAGGGAGAAAATTGATGGAGTGAAATTGGAATCAATGGGAGTC
TATCAGATTCTGGCGATCTACTCAACAGTCGCCAGTTCTCTGGTTCTTTTGGTCTCCCTGGGGGCAATCA
GCTTCTGGATGTGTTCCAATGGGTCTTTACAGTGTAGAATATGCATCTAAGACCAGAATTTCAGAAATAT
AAGGAAAAACACCCTTGTTTCTACTA
sequence 2
ATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTT
ATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGT
TAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGT
AAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGT
CCTACATTGTGGAAACACCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGA
GCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGG
CCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAA
ATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGG
GAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAG
AATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAA
GACCCAAAGTGAGGGRTCRAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAAT
AACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCT
GGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAAACACCCAAGGGTGCTATAA
ACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCAC
AAAATTGAGACTGGCCACAGGATTGAGGAATATCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATT
GCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGC
AGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAA
TTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGA
ATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGG
TTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAG
AAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAAC
ACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACA
GAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGT
CGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTA
CAGTGTAGAATATGTATTTAA
In: Biology
What are the differences between embryonic stem cells and oocytes?
In: Biology
Describe SSO, SSP, and SBT test methods that can be performed to determine HLA type?
In: Biology
LaTeisha was finally headed back from Nigeria! This trip had been transformational but she was also
glad to head back home to hot showers, familiar food, and a routine including her own car. Two weeks in
the rural countryside is a lot.... Abuja was her new favorite city! Her church had told them all about the
amazing work the medical missionaries did and she already had her CNA so why not? It would be a great
experience and look good on her application to PA school.
And it was incredible... she helped administer vaccines, culture strep throat, detect atypical pneumonia in
coughing children, just amazing. She was impressed by the resilience of the Nigerian villagers; they were
struggling with drought, the cows were spontaneously aborting the calves, and militias visited from the
north all too often but they quietly persevering all the same. . The villagers inspired her and she knew it
was international medicine she was destined to do for her whole life.
But now, just the morning after her flight landed in Atlanta, she wasn’t feeling so well. She felt it a little
on the plane but that could have just been her fear of lying. She was pretty sure she had a fever now. She
felt kinda achy too – knees and elbows and neck. Not so fun. She still had a week before school so she
could just be lazy and recover. She slept the day away.
The next day, things were worse. Her mom insisted she call a doctor. She was vomiting now and it was...
black. Her mom also said that her eyes looked funny, yellowish. They went to an urgent care clinic near
their house. As the PA on duty, you take her case history, temperature, blood and stool samples. Her
really low blood pressure and the color of the vomit were serious indicators
4.
The pathogen causing
LaTeisha’s illness is _______
5.
This organism is severely damaging LaTeisha’s body. How does it cause damage and what isONE virulence factor
In: Biology