1. Which of the statements are true about the cellular processes that occur during specific phases of the cell cycle in somatic cells? Select all that apply.
   1. During S phase, there is synthesis of cell components required for mitosis.
   2. During S phase, there is expression of proteins and enzymes required for DNA replication.
   3. During cytokinesis, separation of the cytoplasm forms two genetically identical daughter cells.
   4. During the second gap phase, there is separation of replicated chromosomes so that each daughter cell gets the same complement of chromosomes.
   5. During the first gap phase, there is increasing expression of cyclin genes if conditions favor cell division.
      

31. Why does meiosis result in more genetic variation than can be explained by mutation alone?

35. A chemical is added to cells growing in a culture dish. This chemical blocks the completion of DNA replication. In what stage of the cell cycle will the cells be stuck?

36. In diploid organisms, having two homologues of each chromosome can be beneficial if one allele of a gene encodes a nonfunctional protein. Can haploid organisms survive having nonfunctional alleles? Explain your answer.

37. What would be the result if a cell completed interphase and mitosis but failed to complete cytokinesis—how many cells would there be at that point, and how many chromosomes would those cells have in comparison to the parent cell?

38. Describe at least two major differences between mitosis and meiosis.

The Krebs Cycle will transform a [substrate] molecule into 3 [products]

What is the function of NADH and FADH2 in cellular respiration?

When oxygen (O2) accepts electrons in aerobic respiration, it is converted to _________

What happens to the electron's energy as it moves through the electron transport chain?

NADH is recycled back into NAD+ in which of the following phases of aerobic cellular respiration ?

"Oxidative" phosphorylation occurs in the _____ and most directly oxidizes _____

In eukaryotes, during oxidative phosphorylation, synthesis of ATP occurs in the _________ by way of a Proton gradient (pH gradient) that is generated by__________

In prokaryotes, during oxidative phosphorylation, synthesis of ATP occurs in the _________ by way of a Proton gradient (pH gradient) that is generated by__________

Fermentation is the process by which cells generate ATP when _________

During strenuous exercise muscle cells quickly run out of oxygen and...

What sorts of adjustments would P. aeruginosa have to make in adapting successfully to the human lung?

1. Align human cardiac and skeletal isoforms of human myosin-binding protein C. Show alignment. Where these isoforms differ most of all from each other?

2. Predict secondary structure of the region where isoforms are most different. Do you think if it is disordered region or if it has compact tertiary structure?

Answer the following questions in your post:

1. Do you know anyone who has had their DNA analyzed by 23andMe, Ancestry or another company?    How did they feel about it? explain why you think people are motivated to pay to have their DNA analyzed. After listening to the podcasts, would you be interested in testing your DNA? Why or why not?
2. Explain two distinct criticisms of DTC testing as discussed by the experts in the podcasts.   Pick the ones you think are the most important or interesting and pick one from each podcast. Be specific and detailed. Provide the name and criticism of the discussant for each critique you choose. What made you choose these criticisms? Do you agree or disagree with the argument made by the discussant?
3. Identify an important piece of information about the science behind DTC genetic testing that you feel could have been added to or emphasized more in my lecture. How did this information help you to better understand personal genomics? Why do you think it was important and how should be added to (or expanded) in that lecture?

What is Western blot used for? Describe how you would perform a Western blot, starting from the sample preparation step to the final analysis.

ATP is required for both muscle contraction and muscle relaxation. Explain how ATP is used for contraction and how ATP is used for relaxation.

Prior to 1800 in England, the typical moth of the species Biston betularia(peppered moth) had a light pattern. Dark colored moths were rare. By the late 19th century, the light-colored moths were rare, and the moths with dark patterns were abundant.

The cause of this change was hypothesized to be selective predation by birds (JW Tutt, 1896). During the industrial revolution, soot and other wastes from industrial processes killed tree lichens and darkened tree trunks. Thus, prior to the pollution of the industrial revolution, dark moths stood out on light-colored trees and were vulnerable to predators. With the rise of pollution, however, the coloring of moths vulnerable to predators changed to light.

In the late 1900s, England cleaned up its air, and pollution decreased. The bark of trees went from dark to light.

Which of the following outcomes to the populations of peppered moth would you expect given this environmental change?

What is cellular signal transduction? Explain the general principles and features of signal transduction.

What are lipoproteins? Describe their structural features and explain how different classes of lipoproteins are transported in the body.

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

Can you find any mutation, name the domains, if the proteins are conserved, and the amino acid sequences and in which organelle will you find the genetic material that encodes your genes.

>Pseudo-nitzschia multiseries (the homolog of the osteroccus tauri)

ATGTCTCAATCTGTATCAGAACGGACTCGAATTAAAAGTGACCGTTACGAATCTGGTGTAATCCCTTACG

CTAAAATGGGTTACTGGGATGCTTCATACACAGTAAAAACTACTGATGTTCTTGCTTTATTCCGTATCAC

ACCACAACCAGGCGTAGATCCTGTTGAAGCTGCTGCTGCAGTAGCTGGTGAATCTTCAACAGCAACTTGG

ACAGTTGTATGGACTGATTTATTAACAGCTTGTGATCGTTACCGAGCTAAAGCTTACCGTGTAGATCCAG

TTCCAAATACATCTGATGTTTTCTTTGCTTTCATCGCATACGAATGTGATTTATTCGAAGAAGGTTCTTT

ATCTAACTTAACAGCATCTATTATTGGTAACGTATTCGGTTTCAAAGCTGTATCAGCTTTACGTTTAGAA

GACATGCGTATTCCTCACTCATACTTAAAAACATTCCAAGGTCCTGCAACAGGTATCGTTGTAGAACGTG

AACGTTTAAATAAATATGGTGCTCCTTTATTAGGTGCTACAGTAAAACCAAAATTAGGTTTATCTGGTAA

AAACTACGGTCGTGTAGTATTCGAAGGTTTAAAAGGTGGTTTAGACTTCTTAAAAGATGATGAGAACATT

AACTCTCAACCATTCATGCGTTGGAGAGAGCGTTTCTTAAACTGTATGGAAGGTATTAACCGTGCATCTG

CTGCTACAGGAGAAGTAAAAGGTTCTTACTTAAACGTTACAGCTGCTACTATGGAAGAAGTAATCAAACG

TTGTGAGTACGCTAAAGAAGTAGGTTCTGTTATCGTTATGATCGATTTAGTTATGGGTTATACAGCTATT

CAATCTGCTGCTTACTGGGCTCGTGAAAACGATATGCTTTTACACTTACACCGTGCTGGTAACTCTACAT

ATGCACGTCAAAAAAACCATGGTATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCTGGTGTAGA

TCATATCCACGCTGGAACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTACGAT

ACTTTACGTTTAACTCATTTAGAAGTTAATTTACCATACGGTATTTTCTTCGAAATGCCTTGGGCTAGTT

TACGTCGTTGTATGCCAGTAGCATCTGGTGGTATTCACTGTGGTCAAATGCACCAATTAATTCACTACTT

AGGTGATGACGTAGTATTACAATTCGGTGGTGGTACAATTGGTCACCCTGATGGTATCCAAGCCGGTGCT

ACAGCTAACCGTGTTGCTTTAGAAGCAATGGTATTAGCTCGTAACGAAGGTGCTGATTTCTTCAGTAACG

AAGTTGGTCCTCAAATCTTACGTAATGCTGCTAAAACATGTGGTCCATTACAAACTGCATTAGATTTATG

GAAAGATATTAGTTTTAACTACACATCTACAGATACAGCTGATTTCGCTGTAACACCAACTGCAAACGTA

TAA

Does glucose-6-phosphate allosterically inhibit glucokinase AT ALL?

Discuss the impact of public (government) and private controls on long term care.