If you wanted to inhibit neutrophile accumulation at the site of an infection, What mechanism(s) that promote neutrophile accumulation would you target and why?

SUMMARY

This discussion is prompted by two articles. The first article entitled “Genetic variation in chromosome Y regulates susceptibility to influenza A virus infection” by Krementsov et al. introduces the genetic components of human susceptibility to Influenza A virus. The second paper by Lindor et al discusses questions surrounding the increasing genome sequencing information available to healthy individuals.

Several issues arise from the availability of detailed health information including concerns about discrimination and stigmas, as well as the impact on the psychological well-being of those found to be at increased risk for infections, diseases, or conditions. Such sensitive health information also poses ethical, legal, and social challenges for the management of such information (who has access, who is allowed to view such information). The applications of personalized genome information require care and expertise in interpreting genetic data and implementing, for example, changes in lifestyle and behavior.

The background reading includes first, an article titled “Ethical Consequences of Full Human Genome Testing” which discusses privacy concerns over the handling of such genomic information (which may include the quality of individual responses to disease treatment, their health susceptibilities, predictions of their future disease likelihood, their carrier status for certain genetic disease alleles, etc.). Second, an issue brief regarding workplace wellness health screening programs and the rights of workers regarding this information titled “Changing Rules for Workplace Wellness Programs: Implications for Sensitive Health Conditions”.

DISCUSSION PROMPTS

1. After receiving personalized genomic information, how might you use such knowledge with respect to your own health?
2. Would a genetically tested family member providing children or other family members with information regarding genetic information (such as carrier status) be desirable?
3. Might such testing be used as a prerequisite for employment, spousal selection, marriage, adoption, or IVF embryo implantation

Please write about these questions like a small paragraph answering he questions below:

Do you think that microbes can have cooperative traits? Why or why not?

Think about the RNA viruses that evolve as if they were playing the prisoner's dilemma game. What if you did not know about the prisoner's dilemma and you were given the data on fitness at different starting frequencies in the paper presented. How would you interpret those results? Is it useful to think about the data by thinking about the prisoner's dilemma? If this was a virus infecting a human, would you hope that the viruses defect or cooperate? Why? What might you do to try to encourage defection?What is the difference between group and individual selection? Do you think natural selection operates at the level of a group? Why? Why do some scientists think that is problematic? What is kin selection, and how is it expected to affect the persistence of cooperative traits?

How does spatial structure affect the stability of cooperation?

Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'

Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'

Design a splint oligomer and write the all-possible content(s) needed for reaction to occur.

For the last several years scientists have fretted over the future of bees, and although research has shed much light on the crisis, there is still debate on the causes and costs of this issue. In no more than 500 words state your opinion on this topic.

Please illustrate the steps to recombinant cloning of the vector to express c-Myc-GFP-His6 in mammalian cells with detailed DNA sequences of primers. Please explain why the chosen particular vector was used and why the chosen version of the c-Myc gene was used.

Arthropods represent the cumulation of evolutionary development in the protostomes. identify at least three characteristics that contribute to their success. and explain the selective advantage of each exmaple.

The question can be answered in a variety of ways. You are encouraged (and in some case required) to use graphs and diagrams as part of your answer, to illustrate your argument or particular concept. This question requires a discussion of vertebrate cardiovascular system other than human.

The vertebrate cardiovascular (CV) system has a job of delivering a variety of molecules, entrained in plasma, to all the cells in your body. How does it achieve this function effectively (at sufficient rate) and efficiently (with minimal energetic cost)? How does the transport & transfer function differ in extant endotherms and ectotherms? Among vertebrates there's a wealth of circulatory designs, each of which must perform the transport/transfer function. Human CV system is similar only to that of other mammals (and birds, to some extent), but why would you leave out other vertebrates? How do their CV systems work? How good are they at transport? What are the constraints in different CV systems? So much to write about... This discussion should involve different cardiovascular systems.

1. What happens if one solute can pass through the membrane, but another cannot?

2. How do semi-permeable membranes and the processes of diffusion and osmosis contribute to homeostasis in cells?

1- A shallow cut into the trunk of a young tree will often result in the death of any branches above that cut. Explain why this happens

2-On many Ontario highways a plant known as crown vetch is often planted on slopes on the side of the highway. These plants are so important that signs identify them and warn against cutting. A study of the plant shows an extensive root system. Why is this plant grown on embankments?

Health literacy is a growing problem in the United States. How does health literacy impact the ability to conduct epidemiological studies and to improve health?

an isolated population of cats are observed for their frequency in an allele for striped and spotted coloring as well as the actual level of heterozygosity in each population. Allele frequency for stripes is 0.62 and spots 0.38, The observed frequency of heterozygotes is 0.08 What is the inbreeding coefficient of this population? is the population undergoing inbreeding based off of the inbreeding coefficient.

Devise a restriction analysis method to confirm the desired recombinant; use a single most appropriate enzyme. Calculate the expected sizes of the restriction fragments from each, the vector and the desired recombinant

1. How many oxidation steps take place in glycolysis per glucose molecule? How many phosphorylation steps per glucose molecule?

2. What is the net number of ATP molecules produced per glucose molecule during glycolysis? These ATP molecules are synthesized using which of the phosphorylation mechanisms: substrate level phosphorylation, or oxidative phosphorylation?