Questions
Provide a brief description/explanation about any of the 3 questions: g) Metazoa vs. Eumetazoa h) Problems...

Provide a brief description/explanation about any of the 3 questions:

g) Metazoa vs. Eumetazoa

h) Problems with coral reefs today

i) Largest phylum in the clade Lophotroco

j) The largest phylum within the clade Ecdysozoa; the largest class within that.

k) The largest phylum within the clade Ecdysozoa; the largest class within that.

l) Open vs. closed circulatory systems; note several examples for each.

m) 2 major phyla within the clade Deuterostoma

In: Biology

An agricultural breeder seeks to build a bigger green bean. Truncation selection is applied to a...

An agricultural breeder seeks to build a bigger green bean. Truncation selection is applied to a population and the intensity of selection on bean size is measured as (i = 0.15). In the next generation the response to selection is measured as 0.08. What is the realized heritability of the trait “bean size” in the population?

A) 0.15 B) 0.08 C) 0.082 D) 0.012 E) none of the above

PLEASE show your work/how you got the answer!

Thank you!

In: Biology

1. In the complex reactions that make up cellular respiration, energy is transferred by A. phosphorylation...

1. In the complex reactions that make up cellular respiration, energy is transferred by

A. phosphorylation reactions

B. redox reactions  

C. neither 1 or 2

D. both 1 and 2

2. Respiration of carbohydrate substrates provides more energy than proteins substrates because

A. proteins have no C-H bonds

B. proteins cannot be processed by glycolysis

C. proteins compete with NADH reduction reactions

D. proteins release NH3

3. Which of the 4 stages of respiration is anaerobic, and can continue without oxygen?

A. citric acid cycle

B. glycolysis

C. electron transport and oxidative phosphorylation

D. pyruvate processing

4. ATP is a regulatory molecule for the allosteric enzyme phospho-fructose kinase. This regulatory mechanism of the activity of glycolysis is called:

A. interference inhibition

B. competitive inhibition

C. feedback inhibition

D. active site inhibition

5. The NET output of glycolysis of 1 glucose molecule is

A. 4 ATP, 2 NADH

B. 2ATP, 2 FADH2

C. 2 ATP, 2 NADH

D. 2 ATP, 2 FADH2

6. Which of the four stages of respiration does NOT take place in mitochondria

A. pyruvate processing

B. glycolysis

C. Citric acid cycle

D. electron transport and oxidative phosphorylation

7. The citric acid cycle is a set of sequential reactions where 2 carbon atoms from Acetyl CoA (that derives from a glucose molecule) are coupled to a 4 carbon molecule. The carbon atoms from Acetyl CoA are released as CO2. Redox reactions and phosphorylation reactions are used to harvest energy in the form of ATP, NADH and FADH2. The product of these reactions is again a 4 carbon molecule that can be coupled with 2 carbon atoms from another Acetyl CoA to repeat the whole process

A. true, this is a correct description of the citric acid cycle

B. false, the citric acid cycle starts with pyruvate as substrate

C. false, the citric acid cycle employs only redox reactions

D. false, the citric acid cycle does not yield NADH

8. The net total output of energy rich molecules from respiration of a molecule of glucose after the citric acid cycle is

A. 2 ATP, 50 NADH, 4 FADH2

B. 2 ATP, 10 NADH, 2 FADH2

C. 4 ATP, 10 NADH, 2 FADH2

D. 4 ATP, 2 NADH, 10 FADH2

9. In the absence of oxygen, cellular respiration switches to fermentation. Fermentation is a set of alternative reactions to complete glycolysis and produce 2 ATP for a glucose molecule, by making sure that the following reagent is available

A. NAD (oxidized electron carrier)

B. EtOH (alcohol)

C. NADH (reduced electron carrier)

D. Acetyl CoA (substrate for citric acid cycle)

In: Biology

Choose a sport and using specific examples, explain how 3 types of strength are beneficial to...

Choose a sport and using specific examples, explain how 3 types of strength are beneficial to that sport.

In: Biology

Please describe in detail two examples of mimicry in plants (specific or groups) including at least...

Please describe in detail two examples of mimicry in plants (specific or groups) including at least one example of Batestian mimicry.
Thank you!

In: Biology

Information for question # 21,22, and 23. Allele frequencies at a wing length locus are measured...

Information for question # 21,22, and 23. Allele frequencies at a wing length locus are measured for a natural population of a migratory cricket species as P(A1) = 0.4 and Q (A2) = 0.6. Observed genotype frequencies in the field population are shown below. Compute the expected frequency of the three genotypes if the population is in Hardy-Weinberg Equilibrium for this locus?  

                                     Observed frequency                  Expected frequency       Show your work

             A1A1     =          0.28                  

             A1A2     =          0.22                  

             A2A2  =             0.50                  

21. The expected frequency of the genotypes are:            

a) A1A1  =0.25              A1A2  = 0.50                 A2A2  = 0.25

b) A1A1  =0.28              A1A2  = 0.22                 A2A2  = 0.50

c) A1A1  =0.16              A1A2  = 0.48                 A2A2  = 0.36 - CORRECT ANSWER

d) A1A1  =0.36              A1A2  = 0.48                 A2A2  = 0.16


             e) None of the above

22. Compute the value of the inbreeding coefficient (F) for this population. The inbreeding coefficient is  

A) 0

B) 0.043

C) 0.43

D) 0.54 - CORRECT ANSWER   

E) 1

23. Based on your calculation is there evidence for assortative mating in this population?

a) Yes                           b) No                c)  Not enough information

I just need help with number 23, PLEASE explain how you got the answer!

Thank you!

In: Biology

A missionary couple, living in West Africa bought their 4-year old son to the Emergency room...

A missionary couple, living in West Africa bought their 4-year old son to the Emergency room as he had fever and a pinkish rash has been developing on his hands and feet at first then it spread to both arms and legs. There are no other symptoms that the child feeling very fatigued. 1. This disease is most likely caused by what bacteria? Name the disease. 2. How would epidemiology assist you in finding the sources of this illness? 3. The boy had all of his vaccines so why does he have such a disease? 4. What course of treatment would you order and why? What type of antibiotic would you use and why? 5. What are the virulence factors for the causative agent? Explain the mode of action of these factors

In: Biology

Explain the hematological implications of under experiment( why did they select the study, abstract,what is the...

Explain the hematological implications of under experiment( why did they select the study, abstract,what is the aim, what are things they tested, what do they want to say conclusion etc) long report | please dont answer by hand writting!

Majority of clinical decisions are said to be based on laboratory test results. Therefore, discrepant and unreliable laboratory results may cause serious consequences for the health of individuals and the society. Fifty blood samples were collected from apparently healthy subjects and sent to 3 different participating hospital laboratories designated as A, B and C within northern Nigeria over a ten-week period. The laboratories, all using standard hematology techniques, undertook Hb estimation, total WBC counts and PCV measurements in an inter-laboratory quality control assessment. The study revealed that laboratories B and C obtained significantly lower mean values of 13.20 g/dl and 13.80 g/dl for hemoglobin respectively compared to 14.60 g/dl from the originating laboratory (p<0.01). Meanwhile, the mean WBC values for laboratories B and C appeared significantly higher than the accurate mean. Two laboratories (B and C) also obtained mean values of PCV slightly different from the accurate one while laboratory A had similar mean PCV value to the accurate one. Generally, higher variance ratios between laboratories than between samples (P<0.01) was observed in hemoglobin estimation and WBC count, while PCV showed a high variance ratio between samples than laboratories. However, the reproducibility of test results of participating laboratories was good.

In: Biology

1) The products of DNA replication are two DNA molecules. Which of the following statements about...

1) The products of DNA replication are two DNA molecules. Which of the following statements about these two DNA molecules is false?

a) they are sister chromatids

b) they are both double-stranded DNA helices

c) they carry different sets of gene alleles

d) they each consist of one "old" strand, which was the template strand, and one "new" strand, which was just synthesized

2) In which of the following molecular processes is the formation of Watson-Crick type base pairs between DNA or RNA polynucleotides NOT critical to the mechanism?

a) PCR

b) transcription

c) DNA replication

d) no good answer - all of these depend to some degree upon base pairing interactions

e) translation

d) taking apart the nuclear membrane

In: Biology

True/False: 1. If you ask a population ecologist, all the individuals in a population belong to...

True/False:

1. If you ask a population ecologist, all the individuals in a population belong to the same species.

2. A single population might exist in multiple territories that do not overlap, with no migration of individuals between territories.,

3. A population's carrying capacity depends on the action of parasites.

4. Most populations have a random dispersion pattern.

5. In general, animals are most likely to die at an age near their maximum possible lifespan.

In: Biology

List and describe common forms of fraud and abuse.

List and describe common forms of fraud and abuse.

In: Biology

Q. Identify and explain how the system of a single cell is supposed to function in...

Q. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the item listed below. This means explaining how all aspects of the cell (inside and outside) may be impacted by this problem.

-Make sure to fully explain the item listed in the cellular dysfunction as well as all other related items in the system of a cell.

1. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

1a. Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

1b. Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

In: Biology

what is the role of adenyl cyclase in cellular signal transduction?

what is the role of adenyl cyclase in cellular signal transduction?

In: Biology

Explain the regulation of the allosteric enzyme acetyl-CoA carboxylase by citrate and palmitoyl-CoA.

Explain the regulation of the allosteric enzyme acetyl-CoA carboxylase by citrate and palmitoyl-CoA.

In: Biology

6. Lungless salamanders live in moist habitats and can die if their skin dries out. Yet,...

6. Lungless salamanders live in moist habitats and can die if their skin dries out. Yet, some species cannotlive in water as adults and will drown if fully immersed. Why might this occur (consider the functional disadvantage of lungs in underwater) ? Why must their skin remain moist?

7. Define death in physiological terms. We know that when the human heart stops beating, it can be started again artificially. And, the subject lives. If the heart does not restart, the O2 supply is cut off, the brain "dies," but what does lack of O2 cause? Take your answer as far down (reductionistically) as you can.

8. You have designed a new drug (Provasoshut®) that acts as an agonist of alpha-adrenergic receptors. In most of the systems you have studied (e.g. capillary beds of the digestive system, liver, and adipose), Provasoshut® causes vasoconstriction that lasts for at least 15 minutes. However, when you tried the drug on the capillary beds of the contracting muscle of the frog leg prep in your physiology lab, the vasoconstriction lasted only 20 seconds! What is the best explanation for the short-lived action of Provasoshut® in this preparation?

9. A vampire bat survives on mammalian blood. Most cells in blood are erythrocytes filled mostly with water and hemoglobin. Most of plasma is water and its most abundant solute is albumin. Predict how the urine of a vampire bat would differ compared to an omnivorous mammal such as you.

In: Biology