Questions
True/False: 1. If you ask a population ecologist, all the individuals in a population belong to...

True/False:

1. If you ask a population ecologist, all the individuals in a population belong to the same species.

2. A single population might exist in multiple territories that do not overlap, with no migration of individuals between territories.,

3. A population's carrying capacity depends on the action of parasites.

4. Most populations have a random dispersion pattern.

5. In general, animals are most likely to die at an age near their maximum possible lifespan.

In: Biology

List and describe common forms of fraud and abuse.

List and describe common forms of fraud and abuse.

In: Biology

Q. Identify and explain how the system of a single cell is supposed to function in...

Q. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the item listed below. This means explaining how all aspects of the cell (inside and outside) may be impacted by this problem.

-Make sure to fully explain the item listed in the cellular dysfunction as well as all other related items in the system of a cell.

1. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

1a. Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

1b. Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

In: Biology

what is the role of adenyl cyclase in cellular signal transduction?

what is the role of adenyl cyclase in cellular signal transduction?

In: Biology

Explain the regulation of the allosteric enzyme acetyl-CoA carboxylase by citrate and palmitoyl-CoA.

Explain the regulation of the allosteric enzyme acetyl-CoA carboxylase by citrate and palmitoyl-CoA.

In: Biology

6. Lungless salamanders live in moist habitats and can die if their skin dries out. Yet,...

6. Lungless salamanders live in moist habitats and can die if their skin dries out. Yet, some species cannotlive in water as adults and will drown if fully immersed. Why might this occur (consider the functional disadvantage of lungs in underwater) ? Why must their skin remain moist?

7. Define death in physiological terms. We know that when the human heart stops beating, it can be started again artificially. And, the subject lives. If the heart does not restart, the O2 supply is cut off, the brain "dies," but what does lack of O2 cause? Take your answer as far down (reductionistically) as you can.

8. You have designed a new drug (Provasoshut®) that acts as an agonist of alpha-adrenergic receptors. In most of the systems you have studied (e.g. capillary beds of the digestive system, liver, and adipose), Provasoshut® causes vasoconstriction that lasts for at least 15 minutes. However, when you tried the drug on the capillary beds of the contracting muscle of the frog leg prep in your physiology lab, the vasoconstriction lasted only 20 seconds! What is the best explanation for the short-lived action of Provasoshut® in this preparation?

9. A vampire bat survives on mammalian blood. Most cells in blood are erythrocytes filled mostly with water and hemoglobin. Most of plasma is water and its most abundant solute is albumin. Predict how the urine of a vampire bat would differ compared to an omnivorous mammal such as you.

In: Biology

Describe the following methods of grafting and budding with drawings: Cleft graft Whip-and-tongue graft        c.  T-budding        d.  Chip...

Describe the following methods of grafting and budding with drawings:

  1. Cleft graft

  1. Whip-and-tongue graft

       c.  T-budding

       d.  Chip budding

In: Biology

1. What is the difference between a phytohormone and a plant growth regulator? 2. Contrast a...

1. What is the difference between a phytohormone and a plant growth regulator?

2. Contrast a tap root vs. an adventitious root

3.Describe the difference between heel cuttings and mallet cuttings.

In: Biology

All the vertebrates are chordates – and all tetrapods are vertebrates – and all amniotes are...

All the vertebrates are chordates – and all tetrapods are vertebrates – and all amniotes are tetrapods. Each of these leading to the amniotes resulted in major morphological change.

a) How do you explain the major differences in terms of evolutionary selection for each of these groups?

b) Why are intermediate organisms (like the Tiktallik) often species which don't survive for long periods in the fossil record?

In: Biology

Which cell-cell connection allows for the formation of a gradient of 2nd messengers, small molecules or...

Which cell-cell connection allows for the formation of a gradient of 2nd messengers, small molecules or ions in the cytosol of neighboring animal cells?

a Plasmodesmata

b Adherens junction

c Gap junction

In: Biology

What is the purpose of adding precision plus standard in SDS-PAGE? What will happen if we...

What is the purpose of adding precision plus standard in SDS-PAGE? What will happen if we do not use it in our analysis?

In: Biology

The overall effectiveness of a health system can be measured in a number of different ways....

The overall effectiveness of a health system can be measured in a number of different ways. Health outcomes are an obvious measure and one that is tied directly to access to quality clinical care. The tracking of health outcomes involves tracking the progress of patients who present a chronic condition, such as hypertension, and then measuring the results after drug therapy and lifestyle changes. Additionally, patient satisfaction is a reasonable measure of the effectiveness of a health system. Measures of health outcomes, patient satisfaction, and cost reduction, when coupled together, are significant performance indicators for monitoring the overall effectiveness of a health system. The catalyst of U.S. healthcare reform and modernization is identifying, monitoring, and measuring the key performance indicators of cost, access, and quality.

Introduction

Measuring the cost of healthcare delivery is critical to evaluating the overall effectiveness of health systems. As noted by Porter and Lee (2013), “Improving value requires either improving one or more outcomes without raising costs or lowering costs without compromising outcomes or both” (p. 52). For example, the Patient Protection and Affordable Care Act (ACA) of 2010 sought to transform the U.S. healthcare system by creating synergies, efficiencies, and economies of scale that would reduce the cost of care delivery by spreading it across population health and disease management programs (Lathrop & Hodnicki, 2014).

Accountable care organizations (ACOs) are now part of value-based health services delivery and have grown in popularity since their inception over a decade ago. Despite the official-sounding description, an ACO is not a legal entity; rather ACOs are voluntarily established by healthcare providers, health plans, and hospitals to increase consumers’ access to health services and to reduce the collective costs of doing business.

Case Report

During the summer of 2018, Blue Cross and Blue Shield, the Texas-based health insurance behemoth, entered an ACO relationship with Baylor Scott & White Health, the largest nonprofit health system in Texas. Under the agreement, in year one Baylor Scott & White would provide high-quality care to upwards of 140,000 Blue Cross and Blue Shield members, establishing it as the most substantial value-based care agreement with a commercial insurance company in the United States (Rege, 2018). Improvements in health outcomes for those with chronic diseases such as diabetes, hypertension, and obesity can build patients’ confidence in the ACO model resulting from increased quality of life, leading to higher levels of customer satisfaction in the health system.

Discussion

The shift from healthcare delivery based on patient demand to a more proactive approach will require a complete commitment from all healthcare stakeholders. Due to its ACO alignment, Baylor Scott & White Health had over 1 million lives under value-based care arrangements, and stakeholders believe that their patients will receive high-value, coordinated, and quality care (Rege, 2018). Designing, implementing, coordinating, and managing the delivery of health services can increase care and oversight across the entire continuum of patient care (Wexler et al., 2014). These tighter controls at the point of service will lower costs across the entire system. Increasing emphasis on disease prevention will directly affect the rate of chronic conditions and traditional high-cost illnesses. Moreover, financial risk pools will create economies of scale as younger and healthier patients begin to purchase insurance plan resulting from the ACA mandates. Health policies and reforms such as the ACA demonstrate the government's meaningful efforts to reduce costs and increase access to and quality of care. These types of national standards are enforceable by government agencies with far-reaching authority. The lower cost of medical procedures coupled with reduced reimbursement rates from Medicare and Medicaid will fundamentally alter health care delivery in the United States.

Questions

  1. Discuss the interrelationship between cost, access, and quality in the delivery of health services. Briefly describe the impact of each measure on positive patient health outcomes.
  2. Under the ACA, describe a scenario of how medical providers and healthcare professionals work together to enhance the quality of health initiatives, interventions, or outcomes.
  3. In your opinion, what role will ACOs play in the future environment of value-based health services delivery? Explain your answer by integrating an example of how an ACO can either reduce costs, increase patient satisfaction, or improve health outcomes.

In: Biology

Question: explain how nerve impulses are transmitted, describe Na-K pump, the role of ATP, calcium and...

Question: explain how nerve impulses are transmitted, describe Na-K pump, the role of ATP, calcium and neurotransmitted

In: Biology

phamacology 1 homework: Giving examples, explain how the bioavailability of drugs would be affected by these...

phamacology 1 homework:

Giving examples, explain how the bioavailability of drugs would be affected by these administration routes: oral ,sublingual, and rectal administration routes

In: Biology

Pick the INCORRECT answers to the following question: (may be multiple answers) A. ER bound ribosomes...

Pick the INCORRECT answers to the following question: (may be multiple answers)

A. ER bound ribosomes translate proteins destined to be secreted outside the cell

B. Free ribosomes translate many proteins in the cytoplasm

C. Ribosomes form a bridge between the nuclear membrane, where they capture mRNA molecules as the exit the nucleus, and the cell membrane, where they pump newly made proteins outside the cell

D. ER bound ribosomes translate proteins destined for localization in the membrane

E. Free ribosomes translate many proteins destined for localization in the membrane

In: Biology