Information for question # 21,22, and 23. Allele frequencies at a wing length locus are measured for a natural population of a migratory cricket species as P(A₁) = 0.4 and Q (A₂) = 0.6. Observed genotype frequencies in the field population are shown below. Compute the expected frequency of the three genotypes if the population is in Hardy-Weinberg Equilibrium for this locus?  

                                     Observed frequency                  Expected frequency       Show your work

             A₁A₁     =          0.28                  

             A₁A₂     =          0.22                  

             A₂A₂  =             0.50                  

21. The expected frequency of the genotypes are:            

a) A₁A₁  =0.25              A₁A₂  = 0.50                 A₂A₂  = 0.25

b) A₁A₁  =0.28              A₁A₂  = 0.22                 A₂A₂  = 0.50

c) A₁A₁  =0.16              A₁A₂  = 0.48                 A₂A₂  = 0.36 - CORRECT ANSWER

d) A₁A₁  =0.36              A₁A₂  = 0.48                 A₂A₂  = 0.16

             e) None of the above

22. Compute the value of the inbreeding coefficient (F) for this population. The inbreeding coefficient is  

A) 0

B) 0.043

C) 0.43

D) 0.54 - CORRECT ANSWER   

E) 1

23. Based on your calculation is there evidence for assortative mating in this population?

a) Yes                           b) No                c)  Not enough information

I just need help with number 23, PLEASE explain how you got the answer!

Thank you!

A missionary couple, living in West Africa bought their 4-year old son to the Emergency room as he had fever and a pinkish rash has been developing on his hands and feet at first then it spread to both arms and legs. There are no other symptoms that the child feeling very fatigued. 1. This disease is most likely caused by what bacteria? Name the disease. 2. How would epidemiology assist you in finding the sources of this illness? 3. The boy had all of his vaccines so why does he have such a disease? 4. What course of treatment would you order and why? What type of antibiotic would you use and why? 5. What are the virulence factors for the causative agent? Explain the mode of action of these factors

1) The products of DNA replication are two DNA molecules. Which of the following statements about these two DNA molecules is false?

a) they are sister chromatids

b) they are both double-stranded DNA helices

c) they carry different sets of gene alleles

d) they each consist of one "old" strand, which was the template strand, and one "new" strand, which was just synthesized

2) In which of the following molecular processes is the formation of Watson-Crick type base pairs between DNA or RNA polynucleotides NOT critical to the mechanism?

a) PCR

b) transcription

c) DNA replication

d) no good answer - all of these depend to some degree upon base pairing interactions

e) translation

d) taking apart the nuclear membrane

List and describe common forms of fraud and abuse.

Q. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the item listed below. This means explaining how all aspects of the cell (inside and outside) may be impacted by this problem.

-Make sure to fully explain the item listed in the cellular dysfunction as well as all other related items in the system of a cell.

1. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

1a. Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

1b. Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

Explain the regulation of the allosteric enzyme acetyl-CoA carboxylase by citrate and palmitoyl-CoA.

6. Lungless salamanders live in moist habitats and can die if their skin dries out. Yet, some species cannotlive in water as adults and will drown if fully immersed. Why might this occur (consider the functional disadvantage of lungs in underwater) ? Why must their skin remain moist?

7. Define death in physiological terms. We know that when the human heart stops beating, it can be started again artificially. And, the subject lives. If the heart does not restart, the O2 supply is cut off, the brain "dies," but what does lack of O2 cause? Take your answer as far down (reductionistically) as you can.

8. You have designed a new drug (Provasoshut®) that acts as an agonist of alpha-adrenergic receptors. In most of the systems you have studied (e.g. capillary beds of the digestive system, liver, and adipose), Provasoshut® causes vasoconstriction that lasts for at least 15 minutes. However, when you tried the drug on the capillary beds of the contracting muscle of the frog leg prep in your physiology lab, the vasoconstriction lasted only 20 seconds! What is the best explanation for the short-lived action of Provasoshut® in this preparation?

9. A vampire bat survives on mammalian blood. Most cells in blood are erythrocytes filled mostly with water and hemoglobin. Most of plasma is water and its most abundant solute is albumin. Predict how the urine of a vampire bat would differ compared to an omnivorous mammal such as you.

Describe the following methods of grafting and budding with drawings:

1. Cleft graft

2. Whip-and-tongue graft

       c.  T-budding

       d.  Chip budding

1. What is the difference between a phytohormone and a plant growth regulator?

2. Contrast a tap root vs. an adventitious root

3.Describe the difference between heel cuttings and mallet cuttings.

All the vertebrates are chordates – and all tetrapods are vertebrates – and all amniotes are tetrapods. Each of these leading to the amniotes resulted in major morphological change.

a) How do you explain the major differences in terms of evolutionary selection for each of these groups?

b) Why are intermediate organisms (like the Tiktallik) often species which don't survive for long periods in the fossil record?

Which cell-cell connection allows for the formation of a gradient of 2nd messengers, small molecules or ions in the cytosol of neighboring animal cells?

a Plasmodesmata

b Adherens junction

c Gap junction

What is the purpose of adding precision plus standard in SDS-PAGE? What will happen if we do not use it in our analysis?