Match the type of genetic cross to the expected Mendelian ratios that would result.

QUESTION 8 1. Are all bacteria competent for transformation?

a. Yes they are all competent b. No, some bacteria in nature can do it and in the lab scientists can force bacteria to be competent. o c. No and nothing can be done about it d. no only yeast are competent 10 points

QUESTION 9 1. Which enzyme "glues" DNA fragments together?

a. DNA Ligase b. DNA Recombinase c. all these enzymes d. DNA Reductase 10 points

QUESTION 10 1. Which of these is an example of xenotransplantaion

a. Using a pig retina to treat eye disease in a man b. Using stem cells to treat cancer c. cloning a pet d. Kidney donation from a father to a son

1- How the cancer is related to the cell cycle?

2- What are the general methodologies for cancer treatment?

3- Please describe the terms below: chromatin, chromosome, chromatid, centrosome.

4- What is the importance of meiosis and what are the main stages of the meiosis?

5- Please fill in blanks in the table

THE DIFFERENCES BETWEEN MEIOSIS AND MITOSIS

6- Please explain what the Human Genome Project is, and also explain the importance of the project.

7-What is gel electrophoresis? And explain how we can use this technology in forensic science.

8-Please explain how can a biochip, the one type in which used for a gene microarray, identify the precise form of cancer.

9-Please explain the Darwins’s Theory of Natural Selection in four steps.

10-

According to Hardy-Weinberg equilibrium, a population’s allele and genotype frequencies are inherently stable, so please prove this theory by filling the table below (zygote genotype and its frequency) and generate the Hardy-Weinberg formula

1) When orchid fanciers reproduce orchids they call it meristeming. Do you suspect that they are producing orchids via sexual or asexual reproduction? How do you suspect they are producing more orchids?

2)Describe the process of rhizobial infection and nodule development in a legume root. When legumes are grown in soil that has excess nitrogen available it does not make root nodules. Why not?

Answer all the questions.

Short answer:

Is there a difference between Body cavities and body systems, Explain?

Name the 5 cavities, and the organs that are contained within each cavity?

What are the organ functions?

What are the 2 different surgeries to remove gallbladder? Explain why you would have one over the other (include citations).

planes of the body: identify what organs are on each plane.

1. Dolly the sheep was a sheep that was born to an unrelated mom. Her genome was inserted into an egg that had the DNA removed. This is an example of

a. RNA sequencing b. cloning c. Genetic engineering d. RNA interference 10 points

QUESTION 7 1. What is "gene expression"?

a. DNA that is known to contain genes that can be expressed b. the movement of genes from one cell to the other c. the production of mRNA and proteins that occurs when a gene is transcribed at certain times in the life of the cell d. the production of mRNA and proteins that occurs when a gene is transcribed at certain times in the life of the cell

homozygous recessive is crossed with a heterozygote, what percent chance is there of getting a heterozygous genotype in f1?

1. How much time should be allowed to elapse once a kosher meat product has been consumed, before the consumption of a Kosher-dairy product is to be consumed?

2. Convert the basic ingredients used to produce ‘pastry cream’ into an authentic ‘vegan’ version.

1. Give five steps to making a dual resistant bacteria containing genes for resistance to ampicllin and Kanamycin

1.

2.

3.

4.

5.

2. State three importatn components of a vector

1.  Successful reproduction requires the precise coordination multiple, diverse processes in time and space. Similar to other species, these diverse processes are often regulated by a single factor.

A. Describe the multiple purposes and processes LH are involved in within the reproductive tract that permits the successful meeting of sperm and newly ovulated oocyte though the time the sperm is in proximity to the cumulus oophorus.

B. Describe the when, where and how of the multiple critical processes calcium induces or is involved in (i) within the reproductive tract and (ii) after the sperm attaches to the oocyte and (iii) after it enters the cytoplasm.

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Questions: (Just need the answer to #3)

1. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the items listed above. This means explaining how all aspects of the cell (inside and outside) may be impacted by these problems. The chain reaction of the system inside the cell. Some of them may be related and some of them might not, ultimately whether you can show the relationships demonstrates to me your understanding of the complexity and system of the cell.

a. Make sure to fully explain all of the items listed in the cellular dysfunction as well as all other related items in the system of a cell.

2. Identify and explain any causes that you believe may be associated with these cellular problems in one cell.

3. Explain how your team might be able to fix the one cell with these problems using cell biology and bioscience applications, such as Gene Therapy, developing new organelles, mitochondrial therapy, etc.