10. In Saccharomyces cerevisiae, cell type is determined by which genes are present at the MAT locus. Describe the function of the a1, 1 and 2 proteins in each of the three cell types (a-haploids, -haploids and diploids).

Anion exchange chromatography

1. In the purification, the pH of the PBS buffer was 6.5, and the two proteins have different isoelectric points (Haemoglobin pI: pI 6.8; Catalase: pI 5.4). What are the charge states of the two proteins at this pH? (e.g. positively charged, negatively charged or neutral)

2. Based on the charge states of the proteins, which protein has a higher affinity to the DEAE-Sepharose resin at pH 6.5?

3. Why was the salt concentration of PBS buffer increased (from 17.5 mM to 175 mM) in order to elute out the catalase protein?

Chlamydia trachomatdryisis an obligatekml intracellular parasite and cannot be cultured in artificial media. The commonly used method for detecting this organism is _________________
a)polymerase chain reaction
b)selective liquid media
c)growth selective media
d)chlamydia trachomatis selective

In the fruit fly Drosophila melanogaster, wild type eye color is a brick red color and is produced by the action of two genes, one producing red color, the other brown. Vermilion is an X-linked recessive mutation that results in a bright red eye. Brown is an autosomal recessive mutation that results in a brown eye. Flies carrying both the vermilion and brown mutations produce no pigment and have white eyes. True breeding Vermilion eyed females are crossed to brown eyed males

a. Determine the genotype of the parental flies

b. Diagram the cross and determine the F1 genotypic and phenotypic ratios

c. Diagram the cross when the F1 progeny are mated to produce an F2 generation. Determine the F2 genotypic and phenotypic ratios. You must correctly use the forked line method (branch diagram).

How do amphiphilic emulsifiers work in the emulsion?

List and briefly describe 4 functional properties of sugars (i.e. how these affect food systems)?

In 200-250 words answer: What is artificial photosynthesis and how does it work? Provide a detailed description, which includes naming the key components, their functions, and their counterparts within the chloroplast. What is biomimicry and why is artificial photosynthesis a good example? How do we currently retrieve and produce energy? List at least two problems with our current energy source and explain how artificial photosynthesis resolves these problems.

Summarize how cellular respiration and photosynthesis are important to the carbon cycle.

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC

The strand is transcribed from left to right and codes for a small peptide.

a) Is this the mRNA-like coding strand or template strand?

b) Which end is the 3' end and which is the 5' end?

c) What is the DNA coding strand sequence of the ORF ?

d) What is the sequence of the entire transcript (assume the +1 of transcription begins at the first nucleotide shown)?

e) What is the amino acid sequence of the peptide?

Explain how you can use a filter paper to sterilize a liquid drug to make it safe for someone with immunodeficiency. What type of filter should you use?

The Potassium Channel is a protein that lives in the plasma membrane in both eukaryotic and prokaryotic cells. Describe the path that the Potassium Channel takes to end up in the plasma membrane of eukaryotic cells and the path it takes in prokaryotic cells (starting from it’s DNA sequence).

3 quotes of marine biologists about their careers with names of the person who said it.

Genetics: Combined Factor V & VIII

Part 1: Describe what happens to the product of the gene that causes the double clotting factor disorder in the ER and the golgi apparatus.Describe what happens to the product of the gene that causes the double clotting factor disorder in the ER and the golgi apparatus.

Part 2: What is the evidence that a mutation in a single gene causes this double deficiency? That is, how does the inheritance pattern differ from what it would be if families inherited each condition independently?

5) Every vertebrate is a chordate but not every chordate is a vertebrate. Compare the three groups we discussed in the non-vertebrate chordate lecture (Hemichordata, cephalochordate, urochordata) and explain the differences between the following in one or two paragraphs:

i) between the groups

ii) between those phyla and the vertebrates.

iii) describe the relationship of the hemichordates to other deuterostomes.

iv) What physical feature found in all of these groups is an advantage that has led to “pre-adaptedness” in the chordates? What does that physical feature allow that creates this opportunity?

Why do you think the topic of Early Human migration to America is controversial for archaeologists?