Select one form of SPECIATION and share your rendition of this process of speciation. You can upload a drawing you have made or you can list the steps that occur. Once again mutation which provides variation is at the heart of the process. Mutation is the engine that runs evolutionary change. IF VARIATION IS NOT PRESENT IN THE ORIGINAL POPULATION THERE IS NO VARIETY AVAILABLE TO ADAPT TO THE NEW ENVIRONMENT AFTER THE CHANGE IN THE HABITAT OCCURS . IF YOU SAY THAT THE CHANGE IN THE ENVIRONMENT MAKES A MUTATION HAPPEN YOU WILL NOT RECEIVE CREDIT - BECAUSE THIS IS NOT CORRECT. MUTATIONS OCCUR RANDOMLY - NOT ON DEMAND

Make sure you account for this in your rendition.

By this I mean, you must show that a mutation has randomly occurred in the species prior to any other steps occurring. Once again showing the steps in the process is what is important here.

Draw or list each step in an example of speciation.

Allopatric speciation is just a fancy name for speciation by geographic isolation,

Peripatric speciation is a special version of the allopatric speciation model and happens when one of the isolated populations has very few individuals.

Sympatric speciation does not require large-scale geographic distance to reduce gene flow between parts of a population. Merely exploiting a new niche may automatically reduce gene flow with individuals exploiting the other niche.

In parapatric speciation, Individuals are more likely to mate with their geographic neighbors than with individuals in a different part of the population’s range.

1. Who is Jared Diamond and what are his arguments?

2. How does he support his arguments? What evidence does he utilize/provide to substantiate his claims?

3. In terms of the three segments, how does he relate these factors (guns, germs, steel), to the modern era? 4. Are there any conclusions we can draw from his work that relates to the current pandemic? Please explain.

Explain how one could use the CRISPR system to generate a GFP C-terminal fusion to a protein (i.e. GFP should lie downstream of the sequences for your protein of interest.) Sketch a diagram to help explain your set-up, and be sure to upload an image of your drawing with your assignment. Explain your set-up clearly in writing.

What part of the inverted microscope is different than on a brightfield microscope?

a. The stage and the specimen

b. The light path

c. The coarse adjustment knob

d. The stage

e. The fine adjustment knob

f. All of these

What evidence is there that mutations in Sonic hedgehog can in fact cause holoprosencephaly? Is it convincing?

In a discussion with the mother after the birth of the child, Dr. Reed asked if the mother had diabetes or if she had consumed any alcohol during pregnancy. Why did Dr. Reed want to know this information?

1. tell about the Opium Wars.

____________is a feature of many microbial eukaryote life cycles, which include a multicellular diploid phase and a multicellular haploid phase.
A) Sporic life B) Conjugation C) Gametic D) Zygotic E) all of the previous

24.A reaction has a deltaG of 5.6 kcal/mol. Which of the following would most likely be true?

A. The reaction would result in products with a greater free-energy than in the reactants.

B. The reaction could be coupled to and thus powered by another reaction with a deltaG of -1.0 kcal/mol.

C. The reaction would release free energy.

D. The reaction is spontaneous.

E. The reaction is exergonic.

26. If we follow the oxidation of just one molecule of glucose, how many net ATP have been formed up to the end of the citric acid cycle?

A. 3

B. 2

C. 4

D. 5

E. 8

31.The Na+/K+ pump consummes a considerable amount of the total ATP produced by the cell (~30% for most cells and up to 70% in neurons), so this pump is critical for cellular function. Which of the following is true?

A. This pump contributes to a positive interior charge and thus resets the resting membrane potential of a neuron.

B. This pump is an example of passive transport.

C. This pump is a channel protein.

D. In the animal gut, the Na+ gradient generated by this pump is used to actively move glucose into the cell via coupled transport.

E. This pump hydrolyzes two ATP for each cycle through its conformations to move three Na+ ions and two K+ ions.

33. Which of the following is false regarding the structure of aquaporin?

A. The pore of this channel is selective and only allows water to cross the membrane.

B. The transmembrane portions of this channel that interact with the nonpolar tails of phospholipids are expected to be mostly hydrophobic amino acids.

C. This is an integral membrane protein that provides a pore through the membrane.

D. The pore of this channel is expected to be lined with hydrophobic amino acids.

34. Which of the following statements is a correct distinction between autotrophs and heterotrophs?

A. Only heterotrophs require oxygen.

B. Only autotrophs have mitochondria.

C. Heterotrophs can nourish themselves beginning with CO2 and other nutrients that are inorganic.

D. Autotrophs are the ultimate source of organic compounds for heterotrophs.

E. Cellular respiration is unique to heterotrophs.

34.The Calvin cycle could not occur without the light reactions. Which of the following statements describes why this is the case?

A. ADP and NADH produced in the light reactions provide the energy for the production of sugars in the Calvin cycle.

B. ATP and NADPH produced in the light reactions provide the energy for the production of sugars in the Calvin cycle.

C. ADP and NADP+ produced in the light reactions provide the energy for the production of sugars in the Calvin cycle.

D. Molecular oxygen produced in the light reactions provides the energy for the production of sugars in the Calvin cycle.

E. Photons of light directly activate the enzymes of the Calvin Cycle.

37. The oxygen consumed during cellular respiration is converted to.....
A. NAD+

B. water

C. the organic fuel (ie, glucose)

D. carbon dioxide

E. ATP

the following questions refer to homeostasis.

a) you have just completed your first ironman (a very, VERY strenuous event). you are very hot since this is a very intense race. DESCRIBE ALL THE CHANGES that would occur in your body to restore homeostasis. is this a negative or positive feedback loop? explain. no diagrams please explain thoroughly.

b) describe thoroughly how exactly the endocrine system works and helps to keep the body at homeostasis. no diagrams please explain thoroughly.

2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way.  (GpppG is the 5’ cap)

5’GpppGUAACAUGGUCGGACCAUGAC(A)₂₀₀3’

1. Mutation that removes the editing pocket from isoleucine-tRNA synthetase.

2. Mutation that prevents GTP hydrolysis of eEF1-a.

3. Mutation that prevents binding of GTP by eEF2.

a. Tetracycline is a common medication used to treat bacterial infections. It prevents the aminoacyl-tRNA from binding to the ribosomal subunit. Describe the effect on the cell.

b. The wobble hypothesis predicts that fewer than 61 tRNA molecules are required to read the 61 sense codons. State the minimum number required. Explain.

10.During protein degradation, a polypeptide chain is broken down into individual amino acids. Which of the following is false about this process?

a.It is an exergonic reaction.

b.The products have lower disorder than the reactants.

C.The products have lower free energy than the reactants

D.It is a catabolic process.

E.It is catalyzed by enzymes.

12.You quantitatively determine that an enzyme-catalyzed reaction has a ΔG of -8 kcal/mol. If you half the amount of enzyme in the reaction, what will be the ΔG of this reaction?

A.16 kcal/mol

B. -4 kcal/mol

C. 0 kcal/mol

D. 8 kcal/mol

E. -8 kcal/mol

18. Hemoglobin is a protein responsible for transporting oxygen in the blood of vertebrates. Carbon dioxide binds to hemoglobin at a distinct site from where oxygen binds. However, CO2 binding causes a conformational change in hemoglobin that decreases the protein’s binding affinity for O2. What kind of interaction does this describe?

A. catalyzed interaction

B. covalent binding

C. competitive interaction

D. irreversible interaction

E. allosteric interaction

19. Which of the following states the relevance of the first law of thermodynamics to biology?

A. Photosynthetic organisms produce energy in sugars from sunlight.

B. The total energy taken in by an organism must be greater than the total energy stored or released by the organism.

C. Living organisms must increase the entropy of their surroundings.

D. Energy is destroyed as glucose is broken down during cellular respiration.

E. Energy can be freely transformed among different forms as long as the total energy is conserved.

22. An artificial liposome (ie, a test-tube created vesicle), whose membrane contains no proteins and whose interior is filled with water is dropped into a beaker of 0.03 M sucrose solution (Note: Sucrose is a disaccharide). Which best describes what will quickly happen?

A. Sucrose will diffuse into the liposome.

B. The liposome will shrink as water leaves this vesicle.

C. Since there are no membrane proteins, nothing will cross the membrane.

D. Water will diffuse into the liposome, causing it to burst.

E. Sucrose will diffuse out of the liposome.