Questions
As it turns out, studying banthas is too dangerous for you, and you decide to turn...

  1. As it turns out, studying banthas is too dangerous for you, and you decide to turn your attention to a much less hostile organism, the Ewoks. You begin another project. You find that you have to count hundreds of ewoks. You are committed to the new project, but you secretly wonder if you shouldn’t have stuck with banthas.

You are studying two genes known to be linked, fur color and height.

  • If two genes are linked, where are they located in relation to one another in the genome?
  • Do two genes showing linked inheritance have to show a related function? Why or why not?
  • After you perform your cross, you get the following result:

725 Brown fur, short ewoks

255      Tan fur, tall ewoks

12        Brown fur, tall ewoks

8          Tan fur, short ewoks

What is the recombination frequency between wing shape and body color? Show your work.

In: Biology

Explain how covalent catalysis contributes to the function of the serine protease. Examine each of the...

  1. Explain how covalent catalysis contributes to the function of the serine protease.
  2. Examine each of the different major classes of proteases. In what way is the mechanism of each class similar, and different, to the serine protease mechanism?

In: Biology

How is evolution affecting us/our world right now, as we speak?

How is evolution affecting us/our world right now, as we speak?

In: Biology

10. In Saccharomyces cerevisiae, cell type is determined by which genes are present at the MAT...

10. In Saccharomyces cerevisiae, cell type is determined by which genes are present at the MAT locus. Describe the function of the a1, 1 and 2 proteins in each of the three cell types (a-haploids, -haploids and diploids).

In: Biology

Anion exchange chromatography 1. In the purification, the pH of the PBS buffer was 6.5, and...

Anion exchange chromatography

1. In the purification, the pH of the PBS buffer was 6.5, and the two proteins have different isoelectric points (Haemoglobin pI: pI 6.8; Catalase: pI 5.4). What are the charge states of the two proteins at this pH? (e.g. positively charged, negatively charged or neutral)

2. Based on the charge states of the proteins, which protein has a higher affinity to the DEAE-Sepharose resin at pH 6.5?

3. Why was the salt concentration of PBS buffer increased (from 17.5 mM to 175 mM) in order to elute out the catalase protein?

In: Biology

Chlamydia trachomatdryisis an obligatekml intracellular parasite and cannot be cultured in artificial media. The commonly used...

Chlamydia trachomatdryisis an obligatekml intracellular parasite and cannot be cultured in artificial media. The commonly used method for detecting this organism is _________________
a)polymerase chain reaction
b)selective liquid media
c)growth selective media
d)chlamydia trachomatis selective

In: Biology

In the fruit fly Drosophila melanogaster, wild type eye color is a brick red color and...

In the fruit fly Drosophila melanogaster, wild type eye color is a brick red color and is produced by the action of two genes, one producing red color, the other brown. Vermilion is an X-linked recessive mutation that results in a bright red eye. Brown is an autosomal recessive mutation that results in a brown eye. Flies carrying both the vermilion and brown mutations produce no pigment and have white eyes. True breeding Vermilion eyed females are crossed to brown eyed males

a. Determine the genotype of the parental flies

b. Diagram the cross and determine the F1 genotypic and phenotypic ratios

c. Diagram the cross when the F1 progeny are mated to produce an F2 generation. Determine the F2 genotypic and phenotypic ratios. You must correctly use the forked line method (branch diagram).

In: Biology

How do amphiphilic emulsifiers work in the emulsion? List and briefly describe 4 functional properties of...

How do amphiphilic emulsifiers work in the emulsion?

List and briefly describe 4 functional properties of sugars (i.e. how these affect food systems)?

In: Biology

In 200-250 words answer: What is artificial photosynthesis and how does it work? Provide a detailed...

In 200-250 words answer: What is artificial photosynthesis and how does it work? Provide a detailed description, which includes naming the key components, their functions, and their counterparts within the chloroplast. What is biomimicry and why is artificial photosynthesis a good example? How do we currently retrieve and produce energy? List at least two problems with our current energy source and explain how artificial photosynthesis resolves these problems.

In: Biology

Name one organism outside the animal kingdom that undergoes cellular respiration. Provide a brief explaination on...

Name one organism outside the animal kingdom that undergoes cellular respiration. Provide a brief explaination on how the organism uses cellular respiration.

In: Biology

Summarize how cellular respiration and photosynthesis are important to the carbon cycle.

Summarize how cellular respiration and photosynthesis are important to the carbon cycle.

In: Biology

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC

The strand is transcribed from left to right and codes for a small peptide.

a) Is this the mRNA-like coding strand or template strand?

b) Which end is the 3' end and which is the 5' end?

c) What is the DNA coding strand sequence of the ORF ?

d) What is the sequence of the entire transcript (assume the +1 of transcription begins at the first nucleotide shown)?

e) What is the amino acid sequence of the peptide?

In: Biology

Explain how you can use a filter paper to sterilize a liquid drug to make it...

Explain how you can use a filter paper to sterilize a liquid drug to make it safe for someone with immunodeficiency. What type of filter should you use?

In: Biology

The Potassium Channel is a protein that lives in the plasma membrane in both eukaryotic and...

The Potassium Channel is a protein that lives in the plasma membrane in both eukaryotic and prokaryotic cells. Describe the path that the Potassium Channel takes to end up in the plasma membrane of eukaryotic cells and the path it takes in prokaryotic cells (starting from it’s DNA sequence).

In: Biology

3 quotes of marine biologists about their careers with names of the person who said it.

3 quotes of marine biologists about their careers with names of the person who said it.

In: Biology