what are the affinities of H. floresiensis to Homo habilis?

1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.

A) agarose gel

B) sample mixture

C) positively charged electrode

D) negatively charged electrode

2. The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

A) four

B) three

C) five

D) two

3. The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?

A) four

B) three

C) five

D) two

Read the following examples that use the above terms: A farmer wanted to test the effects of different amounts of fertilizer on tomatoes. He decided to measure the weight of the tomatoes from the plants (yield), since selling his tomatoes generates income. He applies different amounts of fertilizer (the independent variable) to different batches of his plants, and then determines the yield (the dependent variable) of the different batches to decide what amount of fertilizer works best. He includes some unfertilized plants for his control. The yield is dependent on the amount of fertilizer. The amount of fertilizer is independent because the farmer can decide how much he will use. Practice Part A: SCENARIO 1: A microbiologist working for a pharmaceutical company has isolated a chemical from a newly discovered strain of a fungus. He has done some preliminary tests and thinks that the chemical might kill the bacteria that cause gonorrhea. He prepares some bacterial growth medium (aka “agar”) and adds the new chemical to one batch, and leaves one without the antibiotic. He then adds the same amount of the bacteria that cause gonorrhea to each container of growth media and incubates them.

The microbiologist’s hypothesis was that if____________________________________, then ___________________________________________________________________. In this experiment, the antibiotic is the ________________________________________ Whether or not the bacteria can grow in the presence of the antibiotic is the ___________ ________________________________________________________________________ The growth media without the antibiotic is the __________________________________ Why was the same amount of bacteria added to both containers of growth media? _______________________________________________________________________ SCENARIO 2: Phyllis has just purchased a home in Florida. She is very excited about growing plumeria trees in her yard. She wants the trees to produce as many flowers as possible so she decides to test if different amounts of water to see if that has an effect on the number of flowers. Her sprinkler system automatically releases a set amount of water (gallons per minute) so the only way for her to adjust the water amount is to shorten/ lengthen the amount of time the plants get watered. Tree #1 gets watered every day for 2 hours. Tree #2 gets watered every other day for 2 hours. Tree #3 gets watered twice a day for 2 hours each interval. What is the independent variable of this experiment? ________________________________________________________________________ What is the dependent variable of this experiment? ________________________________________________________________________ What is a constant of this experiment? ________________________________________________________________________ What is another constant of this experiment? ________________________________________________________________________

1 pound = ________ kilograms

1 inch = _______ centimeters

1 mile = ___ Kilometers

1 quart = _______ liters

How many liters in a gallon: ___________________

How many quarts, exactly, are in a 3 liter bottle of Coke: __________________

Convert 35 centimeters to inches: _____________________

How many yards are in 1,000 meters: ____________________

How long in meters is the 440 yard dash: ____________________

How many centimeters are in an inch: _____________________

How many grams are in 10 ounces: _____________________

How many kilograms are in 75 pounds: _____________________

How many milliliters are in a liter: ________________

How many millimeters in a kilometer: ____________

How many microliters in a liter: ______________

A millimeter is what fraction of a meter: _______________

A micrometer is what fraction of a millimeter: _______________

A milligram is what fraction of a kilogram: ________________

How many microliters are in a milliliter: _____________

How many meters are in a kilometer: _________________

How many micrometers are in a meter: ________________

A micrometer is what fraction of a meter: __________________

compare protein transport to ER with protein transport from ER to Golgi. what is the diffrence between the two methods?

Design a flow cytometry experiment (Step by step) to test the effect of fish oil on neutral killing cells. Explain in details (Add references if needed)

Please be as discriptive as possible. (Break it down dummy style please) Regarding the posted article “Hepatitis E vaccine debuts: Success of Chinese biotech partnership raises hopes for prevention of overlooked diseases” (Nature 10/29/2012): The workers made a recombinant subunit vaccine in E. coli host cells. Hepatitis E virus is a non-enveloped virus that contains an RNA genome and icosahedral capsid. Describe a stepwise process that could be used to develop and produce the vaccine. You have purified hepatitis E virus genomic RNA as starting material. (side question: if it’s recombinant would cloning be involved why or why not?)

Describe an experiment to compare the stiffness effects of cell vs. extracellular matrix on stem cell using hydrogels.

1. What factors limit the size of cells? Be sure to list at least two factors.
2. How do cells communicate with other cells? Be sure to detail at least one specific example in detail.
3. What are some examples of prokaryotic cells? What are some examples of eukaryotic cells?
4. In what specific ways to antibiotics affect bacteria?

Can a hydropower plant be a baseload plant as well as a peak load
plant? In detail, discuss your answer.

Can someone make an original rap about Prokaryotes Vs Eukaryotes? Thanks

What are cytoskeletal fibres and how are they formed ?