Choose a living organism, and explain how it illustrates each of the characteristics of life.
Research and describe an organism or cell in which all 8 characteristics are not obvious. For example, coral looks like it does not move, red blood cells do not reproduce and have no DNA, frogs freeze in the winter and it therefore seems as if they do not maintain homeostasis, and so on.
Describe the missing feature, and explain how this organism still meets the criteria of a living thing.
Compare a living thing with a nonliving thing of your choice that has some of the characteristics that define life. For example, a car exhibits metabolism (burning gas and producing heat), a characteristic of life, but is not alive because it cannot reproduce.
Compare and contrast the following pairs based on the 8 characteristics that define life:
A rock and a snail
A lamp and a tree
Discuss some of the characteristics that fire shares with living things (it can grow, it metabolizes, and so on).
In: Biology
Which of the following types of inheritance involve epigenetic modifications?
Choose All That Apply (pts deducted for including incorrect answers)
|
maternal effect |
||
|
dosage compensation |
||
|
genomic imprinting |
||
|
extranuclear inheritance |
In: Biology
You are assigned the task of determining the bacterial density of newly-grown culture. You decide that you will analyze the sample with two methods, spectrophotometry and dilution plating. Your results show the sample tested using spectrophotometry had a bacteria density that was roughly ten folds that of the plated sample. Please explain in detail.
In: Biology
COLLAPSE
You receive an specimen in the lab from a patient with an infected throat. Chronicle the steps you would take to identify the bacteria present, starting with what stains, culture media, selective and differential. you would use and why?
In: Biology
what do you think distinguishes our present understanding of epigenetics from Larmarck's, now debunked, theory referred to as the Inheritance of Acquired Characteristics Theory? How, in contrast, might our understandings of the epigenome actually give support to some elements of Lamarckism? What role does epigenetics play in the operation of Natural Selection?
In: Biology
class discussions about categories of biochemical molecules
In: Biology
Make the assumption that a cell has a 10% salt concentration inside its cytoplasm. What factors do you think would influence the rate of diffusion?
In: Biology
vegetative bacterial cells will be killed at _______Centigrade in ______ minutes
In: Biology
How do prokaryotic cells exhibit cellular differentiation? Describe one manner of differentiation and the purpose of such differentiation.
In: Biology
In the lecture on eugenics, we came across the ideas of both positive and negative eugenics. Do you think positive eugenics can achieve the stated goal of improving the quality of our society? Why, or why not? In your answer, be sure to reference the related concepts we covered in the course. Your response should demonstrate your understanding of the principles of inheritance and evolution.
In: Biology
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'
In: Biology
What is science, and how do we use it to solve real-world problems? What is science, and what is biology in particular?
In: Biology
Does freezing influence the stability of mayonnaise? Why?
In: Biology
In: Biology
ANSWER ALL QUESTIONS DON'T ANSWER IF YOU CANT ANSWER ALL I NEED THEM WELL EXPLAINED THANKS
Define perimenopause, surgical menopause, stress menopause, and postmenopause. What are the signs of menopause? What other life changes may influence a women's experience during menopause? Describe women at the highest risk for osteoporosis. Describe the traditional and alternative therapies for the conditions associated with menopause. Design a health, nutrition, and exercise program for middle-aged and older adults
In: Biology