Briefly explain how a medical diagnostic test kit based on gold nanoparticles works. Pitch your answer at the level of a scientifically-literate audience that are not physicists. (A diagram could be useful)
In: Biology
Photosynthesis and Chemosynthesis are unique, but also similar.
Discuss each of their unique properties and similarities. Are
cyanobacteria more plant or animal? Discuss. What makes these
organisms special?
In: Biology
what prevents electrons from flowing in reverse during electron transport after being dropped off by the electron carriers
In: Biology
Discuss the actions taken by prokaryotes when energy substrate conditions and availability concentrations are: 1. glucose present lactose absent, 2. Glucose absent and lactose present, 3. Glucose high and lactose low. Be sure to describe the complete mechanism responsible for the metabolic switch from glucose to lactose metabolism and any factors associated with that change
In: Biology
PCR Practice:
Create forward and reverse primers that amplify the majority of the sequence below. Draw circles around the section of the sequence your primers are taken from. Highlight the region of the sequence that your PCR will amplify. Indicate the 3’ and 5’ ends on your primers.
>gi|297828897|ref|XM_002882285.1| Arabidopsis lyrata subsp. lyrata glyceraldehyde-3-phosphate dehydrogenase C subunit (GAPC), mRNA
CTCCACGTTCTTCTCTCTTTTAAATAGACCCTTCACGGACCCTTCTCACTCACCTATCTCACTGTTAAAT
ATCTCTCTGTGAATCTCATCTTCAACCTCTCTTACACACTCGCGTTTTCGATTCAAACAATGGCTGACAA
GAAGATTAAGATCGGAATCAACGGATTCGGAAGAATCGGTCGTTTGGTTGCTAGAGTTGTTCTTCAGAGG
GACGATGTTGAGCTCGTTGCTGTTAACGACCCCTTCATCACCACTGAGTACATGACCTACATGTTCAAGT
ATGACAGTGTTCACGGTCAATGGAAACACAATGAACTCAAGATCAAGGATGAGAAGACCCTTCTCTTCGG
TGAGAAGCCAGTCACTGTTTTCGGCATCAGGAACCCTGAGGATATCCCATGGGCCGAGGCTGGAGCTGAC
TACGTTGTTGAGTCTACCGGTGTCTTCACTGACAAGGACAAGGCTGCTGCTCACTTGAAGGGTGGGGCCA
AGAAGGTTGTCATCTCTGCCCCCAGCAAAGACGCACCCATGTTTGTTGTTGGTGTCAACGAGCACGAATA
CAAGTCCGACCTTGACATTGTCTCCAACGCTAGCTGCACCACTAACTGCCTTGCTCCCCTTGCCAAGGTT
ATCAACGACAGGTTTGGAATTGTTGAAGGTCTTATGACAACAGTCCACTCTATCACTGCTACTCAGAAGA
CTGTTGATGGTCCATCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTCAACATTATTCCCAGCAG
CACTGGAGCTGCCAAGGCTGTCGGAAAGGTGCTTCCAGCCCTTAACGGAAAGTTGACCGGAATGTCTTTC
CGCGTCCCAACCGTTGATGTCTCAGTTGTTGACCTTACTGTCAGGCTCGAGAAAGCTGCTACCTATGATG
AAATCAAAAAGGCTATCAAGGAGGAATCTGAAGGCAAACTTAAGGGAATCCTTGGATACACCGAGGATGA
TGTTGTCTCAACTGACTTCGTTGGTGACAACAGGTCGAGCATTTTTGACGCCAAGGCTGGAATTGCATTG
AGCGACAAGTTTGTGAAATTGGTGTCATGGTACGACAACGAATGGGGTTACAGTTCCCGAGTGGTCGACT
TGATCGTTCACATGTCAAAGGCCTAAGCTAAGAAGCAGATCTCGAACGGCGAGGAGTGGAAAGTCATCTG
TTCATCCTCTTTTATGGTCTGACTTTGTCGTTTTCGAATAAAATTTCTTTGAACTTGGAACCCTTTTTTT
TTTTTTTTGGTTTTCTTAATTCTCATTCATGTGAGTTGATGGGAGTTTGTAGACCGGTGTTTTACTGAAG
CCCTTTCGTTTTTGGCTTTTGATATATTGAGTTACTTATGGTTTTTCATTTTGTTTCACTTCTCTTTTTT
TCTATATACTAAATCAAATCTGAACGAAC
Forward:_____________________________________________
Reverse:_____________________________________________
- Primers must be 18-30 base pairs in length
- Cannot contain intra-complementary sequences
- Must have a G-C clamp of 2-5 base pairs
- Also include GC content of primers and melting temperature
In: Biology
In: Biology
Q1.Explain why the process of translation has been appropriately named.
Q2. In What ways is the structure of mRNA similar to the DNA?How does mRNA differ from DNA?
In: Biology
6. View the first seven minutes of the following video: “Part 1: Genes that Control Aging” by Dr. Cynthia Kenyon (iBioSeminars). If you would like to learn more about Dr. Kenyon’s research, please feel free to view the entire video! Note: You may copy and paste the link for the video directly into the address bar of your browser: https://youtu.be/DT4PWu43e9U
Then answer the following question:
1.a. What critical observations did Dr. Kenyon’s initial hypothesis explain?
1.b. What was Dr. Kenyon’s initial hypothesis?
1.c. How did Dr. Kenyon and her colleagues test the hypothesis using C. elegans?
1.d. What were their key observations regarding daf-2?
1.e. What conclusions did the observations support?
In: Biology
What is the effect on aviation fuels production?
What is the effect on aviation fuels consumption?
Please answer into details and include diagrams if necessary. Include references if you have used any.
no extra info. I need what effect could happen when we produce and consuen aviation fuels?
In: Biology
Identify any unique characteristics of the Trophosphere:
Select one or more:
a. clouds, rain, winds and storms all occur in this sphere
b. comprised of mostly water vapor
c. is the weather and climate zone
d. greenhouse effect caused by heat trapping gases present in small concentrations
e. nitrogen and oxygen gasses are in the highest concentrations
f. ozone layer exists here
In the Nitrogen cycle, which organisms specifically fix nitrogen gas (N2) from the atmosphere?
Select one:
a. bacteria in the root nodules of legume plants
b. decomposers
c. soil bacteria
d. A and C
e. B and C
Refer to the following equation: Sugar (Glucose) + O2 + H20 --> CO2 + H2O + ATP
Select one:
a. this represents photosynthesis
b. this represents cellular respiration
c. organisms use to produce energy molecules necessary for metabolic reactions
d. A and C
e. B and C
In: Biology
Ch. 3: Molecular diversity
In: Biology
Chapter 7: How Cells Harvest Energy
In: Biology
Complete the missing sequences for wild-type hemoglobin. Label all ends. The protein starts in the provided segment. Hint: Examine Figures 16.4, 16.6, and 16.7 in Biological Science (Sixth Edition).
|
DNA: Non-Template |
5’ - … C C A T G G T G C A C C T G A C T C C T G A G G A G A A G … - 3’ |
|
DNA: Template for Transcription |
|
|
mRNA |
|
|
Protein |
In: Biology
22. The cell walls of plants, fungi, bacteria and archaeans are composed of different polymers yet serve the same function (support and protection). What does this signify about their evolution? (2)
23. Binary fission in bacteria produces a(an)
a. identical copy (clone) of the original cell
b. new combinations of genes in the ‘offspring’
24. The process of a bacterium taking up DNA from its environment is called
25. The process of ‘bacterial sex’ (DNA transferred from one bacterium to another via a pilus) is called
26. The process of genes being transferred between bacteria via a virus is called
27. Why might sexual reproduction in bacteria be important? (2)
28. An organism that produces its own food using energy obtained from the sun is called a
a. photoautotroph
b. heterotroph
c. mixotroph
d. chemoautotroph
29. An organism that must eat other organisms to obtain food/energy is called a
a. photoautotroph
b. heterotroph
c. mixotroph
d. chemoautotroph
30. A protist that can photosynthesize and/or consume another organism is called a
a. photoautotroph
b. heterotroph
c. mixotroph
d. chemoautotroph
31. A prokaryote that can use oxygen if it is present, but can also live in the absence of oxygen is called a(an)
a. facultative anaerobe
b. obligate aerobe
c. obligate anaerobe
32. What is a biofilm? Give an example.
33. Why was Kingdom Protista abandoned (or disbanded) in the early 1990’s?
In: Biology
You are a genetic counselor. As a genetic counselor, you know:
-Dry (as opposed to wet) earwax is an autosomal recessive trait.
-Red-green colorblindness is an X-linked recessive trait.
-Sickle-cell anemia is an autosomal recessive trait.
-The genes for these traits (see above) are located on different chromosomes.
You are counseling a woman and a man, as described below.
Question A. The woman is heterozygous for wet earwax. She has red-green colorblindness. What is the woman’s genotype?
Question B. What are the possible gamete genotypes that she can produce?
Question C. The man has dry earwax. He not have red-green colorblindness. What is the man’s genotype?
Question D. What are the possible gamete genotypes that he can produce?
Question E. The woman and the man are planning to have children. What is the probability that a daughter will have neither dry earwax nor red-green colorblindness? What is the probability that a son will have neither dry earwax nor red-green colorblindness? Hint: Complete a Punnett square
In: Biology