1. What is the importance of generating isolated bacterial colonies?

2. Describe how a bacterial sample would be obtained from and inoculated into each of the following types of media.

Agar slant:

Agar plate:

Broth:

4. What is a subculture?

6. How would a subculture appear if a colony containing both S. marcescens and M. luteus was subcultured to

a slant?

7. Condensation often gathers in the bottom of agar slants. Why is it important in this exercise to limit

condensation on plates but not on slants?

8. Which separation method is not appropriate for use with cultures containing a great deal of bacterial

growth? Why is this method not a good choice for these conditions?

9. Why is agar cooled to 50°C prior to being inoculated with bacteria? What would happen if the agar were

significantly warmer or cooler when inoculated?

10. How could you identify a potential contaminant on a streak plate? A pour plate? A spread plate?

11. How would any of the the isolation techniques seen in this laboratory exercise be affected by the use of

selective medium?

1. Why was it important in this case to identify Salmonella Typhi in the feces of the restaurant worker?

Wouldn’t the discovery of any bacterium be adequate?

2. Which of the three isolation techniques in this exercise would have been least suited to the isolation of

Salmonella Typhi in this case? Why?

3. MacConkey agar is a selective medium that only allows certain types of bacteria to grow. How could

the use of MacConkey agar has simplified the isolation of Salmonella Typhi in this case?

4. Thinking through the case, other than the restaurant workers, when else was microbiological

sampling likely used?

It is illegal to use primates in product testing research; however, primates are used in biomedical and behavioral research. Can you describe any interesting research which utilizes non-human primates as subjects? Did you find this information on the web, in a journal article, through personal experience, etc.?

Diseases that occur at consistent annual rates within a country are referred to as:

Epidemic

Pandemic

Eradicated

Endemic

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse

and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up.

-----

Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis?

5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’

3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’

a) 5’ GGAAAATTCAGATCTTAG 3’;

5’ TGGGCAATAATGTAGCGC 3’

b) 5’ GCTAAGATCTGAATTTTC 3’;

3’ ACCCGTTATTACATCGCG 5’

c) 3’ GATTCTAGACTTAAAAGGC 5’;

3’ ACCCGTTATTACATCGCG 5’

d) 5’ GCTAAGATCTGAATTTTC 3’;

5’ TGGGCAATAATGTAGCGC 3’.

Greg Wilson, a 65-year-old man, is diagnosed with pneumonia. He has a history of congestive heart failure. His physician has ordered an antibiotic for the pneumonia and he takes digoxin every day.

As the health care provider, which question would you ask first before administering his antibiotic? Why is the first dose of the antibiotic twice as much as the maintenance dose? Which variables may slow his metabolism and excretion?

Which group is the furthest from the other two, evolutionarily-speaking?

-Eukarya

-Archaea

-Bacteria

You are a researcher in a biochemistry lab which investigates a novel, globular protein production by yeast. The director of the lab asks you to produce and purify the protein. Unfortunately, you could not obtain any information about if the protein is extracellular or intracellular. Within this scope, please propose a method/methods for isolating the protein after the production process. You have a well-equipped laboratory with the equipment would require to isolate and purify. In addition describe an experiment or set of experiments to prove (or disprove) the protein is composed of more than one subunit.

To date, which is the most biomes is evected by the human?

4. List 5 examples of tropical fruits, including their family, Latin binomial, and a distinguishing feature.

Part A: In a disputed parentage case, the child is blood type O, while the mother is blood type O. What are the possible blood type(s) for the father?

Select all that apply.

O

B

A

AB

Part B: If the child is blood type B, while the mother is blood type O. What blood type would exclude a male from being the father?

Select all that apply.

AB

A

B

O

6. Assessing the population size of organisms is important in determining whether a species requires special conservation effort and in helping to manage sustainable harvesting of food.

a) Why is it important to determine the uncertainty surrounding an estimate of population size? (1 mark)

b) Using an example species and method of population size estimation, explain how you would assess the quality of your population size estimate.

c) Estimating the size of fish species’ populations is very difficult. Imagine that you discovered a new species of fish that appeared to be highly abundant. Given that you probably can’t obtain a reliable population estimate for the species, what other information would you consider when devising a harvesting strategy?

What is the role of acetylation in terms of histones and gene expression?

Please answer and I will give good rating

You have identified a new species of fruit fly and adults have 6 chromosomes. You also discover that this species performs mitosis and meiosis as other eukaryotes. Based on this information how many chromosomes will you expect to find in the following cells.

Mitotic cells just entering G1

Meiotic cells just entering G2

Meiotic cells having completed MI

Mitotic cells during anaphase

Meiotic cells during anaphase II

Describe how a child with one blue eye and one brown eye can be explained through X inactivation. Include the mechanisms involved.