PCR Practice:

Create forward and reverse primers that amplify the majority of the sequence below. Draw circles around the section of the sequence your primers are taken from. Highlight the region of the sequence that your PCR will amplify. Indicate the 3’ and 5’ ends on your primers.

>gi|297828897|ref|XM_002882285.1| Arabidopsis lyrata subsp. lyrata glyceraldehyde-3-phosphate dehydrogenase C subunit (GAPC), mRNA

CTCCACGTTCTTCTCTCTTTTAAATAGACCCTTCACGGACCCTTCTCACTCACCTATCTCACTGTTAAAT

ATCTCTCTGTGAATCTCATCTTCAACCTCTCTTACACACTCGCGTTTTCGATTCAAACAATGGCTGACAA

GAAGATTAAGATCGGAATCAACGGATTCGGAAGAATCGGTCGTTTGGTTGCTAGAGTTGTTCTTCAGAGG

GACGATGTTGAGCTCGTTGCTGTTAACGACCCCTTCATCACCACTGAGTACATGACCTACATGTTCAAGT

ATGACAGTGTTCACGGTCAATGGAAACACAATGAACTCAAGATCAAGGATGAGAAGACCCTTCTCTTCGG

TGAGAAGCCAGTCACTGTTTTCGGCATCAGGAACCCTGAGGATATCCCATGGGCCGAGGCTGGAGCTGAC

TACGTTGTTGAGTCTACCGGTGTCTTCACTGACAAGGACAAGGCTGCTGCTCACTTGAAGGGTGGGGCCA

AGAAGGTTGTCATCTCTGCCCCCAGCAAAGACGCACCCATGTTTGTTGTTGGTGTCAACGAGCACGAATA

CAAGTCCGACCTTGACATTGTCTCCAACGCTAGCTGCACCACTAACTGCCTTGCTCCCCTTGCCAAGGTT

ATCAACGACAGGTTTGGAATTGTTGAAGGTCTTATGACAACAGTCCACTCTATCACTGCTACTCAGAAGA

CTGTTGATGGTCCATCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTCAACATTATTCCCAGCAG

CACTGGAGCTGCCAAGGCTGTCGGAAAGGTGCTTCCAGCCCTTAACGGAAAGTTGACCGGAATGTCTTTC

CGCGTCCCAACCGTTGATGTCTCAGTTGTTGACCTTACTGTCAGGCTCGAGAAAGCTGCTACCTATGATG

AAATCAAAAAGGCTATCAAGGAGGAATCTGAAGGCAAACTTAAGGGAATCCTTGGATACACCGAGGATGA

TGTTGTCTCAACTGACTTCGTTGGTGACAACAGGTCGAGCATTTTTGACGCCAAGGCTGGAATTGCATTG

AGCGACAAGTTTGTGAAATTGGTGTCATGGTACGACAACGAATGGGGTTACAGTTCCCGAGTGGTCGACT

TGATCGTTCACATGTCAAAGGCCTAAGCTAAGAAGCAGATCTCGAACGGCGAGGAGTGGAAAGTCATCTG

TTCATCCTCTTTTATGGTCTGACTTTGTCGTTTTCGAATAAAATTTCTTTGAACTTGGAACCCTTTTTTT

TTTTTTTTGGTTTTCTTAATTCTCATTCATGTGAGTTGATGGGAGTTTGTAGACCGGTGTTTTACTGAAG

CCCTTTCGTTTTTGGCTTTTGATATATTGAGTTACTTATGGTTTTTCATTTTGTTTCACTTCTCTTTTTT

TCTATATACTAAATCAAATCTGAACGAAC

Forward:_____________________________________________

Reverse:_____________________________________________

- Primers must be 18-30 base pairs in length

- Cannot contain intra-complementary sequences

- Must have a G-C clamp of 2-5 base pairs

- Also include GC content of primers and melting temperature

Q1.Explain why the process of translation has been appropriately named.

Q2. In What ways is the structure of mRNA similar to the DNA?How does mRNA differ from DNA?

6. View the first seven minutes of the following video: “Part 1: Genes that Control Aging” by Dr. Cynthia Kenyon (iBioSeminars). If you would like to learn more about Dr. Kenyon’s research, please feel free to view the entire video! Note: You may copy and paste the link for the video directly into the address bar of your browser: https://youtu.be/DT4PWu43e9U

Then answer the following question:

1.a. What critical observations did Dr. Kenyon’s initial hypothesis explain?

1.b. What was Dr. Kenyon’s initial hypothesis?

1.c. How did Dr. Kenyon and her colleagues test the hypothesis using C. elegans?

1.d. What were their key observations regarding daf-2?

1.e. What conclusions did the observations support?

What is the effect on aviation fuels production?

What is the effect on aviation fuels consumption?

Please answer into details and include diagrams if necessary. Include references if you have used any.

no extra info. I need what effect could happen when we produce and consuen aviation fuels?

Identify any unique characteristics of the Trophosphere:

Select one or more:

a. clouds, rain, winds and storms all occur in this sphere

b. comprised of mostly water vapor

c. is the weather and climate zone

d. greenhouse effect caused by heat trapping gases present in small concentrations

e. nitrogen and oxygen gasses are in the highest concentrations

f. ozone layer exists here

In the Nitrogen cycle, which organisms specifically fix nitrogen gas (N2) from the atmosphere?

Select one:

a. bacteria in the root nodules of legume plants

b. decomposers

c. soil bacteria

d. A and C

e. B and C

Refer to the following equation:   Sugar (Glucose) + O2 + H20 --> CO2 + H2O + ATP

Select one:

a. this represents photosynthesis

b. this represents cellular respiration

c. organisms use to produce energy molecules necessary for metabolic reactions

d. A and C

e. B and C

Ch. 3: Molecular diversity

• Relate the structure of each macromolecule with its function
• Contrast the structure of DNA and RNA
• Describe the levels of protein structure and how each level is determined
• Explain the link between protein structure and protein function
• Explain what is denaturation and why it affects protein function
• Explain the structure of lipids and relate it to their function

Chapter 7: How Cells Harvest Energy

• Interpret the role of electrons, electron carriers, and ATP in energy metabolism
• Explain the purpose of oxygen in respiration
• Describe where in the cell and where in mitochondria each process of cellular respiration happens
• Summarize the initial reactants, final products and outcomes of glycolysis, pyruvate oxidation and Krebs cycle. In this summary, track the carbons, the electrons and the ATP produced.
• Illustrate the purpose of the electron transport chain, where those electrons come from and where do they end up.
• Contrasts the two mechanisms for producing ATP and their relative efficiency.
• Distinguish the process and the outcomes between aerobic and anaerobic respiration

Complete the missing sequences for wild-type hemoglobin. Label all ends. The protein starts in the provided segment. Hint: Examine Figures 16.4, 16.6, and 16.7 in Biological Science (Sixth Edition).

22. The cell walls of plants, fungi, bacteria and archaeans are composed of different polymers yet serve the same function (support and protection). What does this signify about their evolution? (2)

23. Binary fission in bacteria produces a(an)

a. identical copy (clone) of the original cell

b. new combinations of genes in the ‘offspring’

24. The process of a bacterium taking up DNA from its environment is called

25. The process of ‘bacterial sex’ (DNA transferred from one bacterium to another via a pilus) is called

26. The process of genes being transferred between bacteria via a virus is called

27. Why might sexual reproduction in bacteria be important? (2)

28. An organism that produces its own food using energy obtained from the sun is called a

a. photoautotroph

b. heterotroph

c. mixotroph

d. chemoautotroph

29. An organism that must eat other organisms to obtain food/energy is called a

a. photoautotroph

b. heterotroph

c. mixotroph

d. chemoautotroph

30. A protist that can photosynthesize and/or consume another organism is called a

a. photoautotroph

b. heterotroph

c. mixotroph

d. chemoautotroph

31. A prokaryote that can use oxygen if it is present, but can also live in the absence of oxygen is called a(an)

a. facultative anaerobe

b. obligate aerobe

c. obligate anaerobe

32. What is a biofilm? Give an example.

33. Why was Kingdom Protista abandoned (or disbanded) in the early 1990’s?

You are a genetic counselor. As a genetic counselor, you know:

-Dry (as opposed to wet) earwax is an autosomal recessive trait.

-Red-green colorblindness is an X-linked recessive trait.

-Sickle-cell anemia is an autosomal recessive trait.

-The genes for these traits (see above) are located on different chromosomes.

You are counseling a woman and a man, as described below.

Question A. The woman is heterozygous for wet earwax. She has red-green colorblindness. What is the woman’s genotype?

Question B. What are the possible gamete genotypes that she can produce?

Question C. The man has dry earwax. He not have red-green colorblindness. What is the man’s genotype?

Question D. What are the possible gamete genotypes that he can produce?

Question E. The woman and the man are planning to have children. What is the probability that a daughter will have neither dry earwax nor red-green colorblindness? What is the probability that a son will have neither dry earwax nor red-green colorblindness? Hint: Complete a Punnett square

What is Counterfeit medications and their negative impacts on health care? paragraph

What are Counterfeit drugs: a growing, global threat ? paragraph

What is the advantage of using double negative 3 cells (DN3) cells to analyse gene expression using real time PCR in leukemia research?

E. coli are able to break down lactose when present, and this is regulated by the lac Operon. Describe the mechanisms for the positive and negative control of this operon, and briefly discuss the advantages of both forms of control for this operon.

What are the goals, advantages, and limitations of designing toys for cerebral palsy therapy? Please discuss in detail