Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below

5’ AACTTCGGCTTAAATGGAGGCCAT’

What is the complementary DNA strand?
What would the mRNA strand look like?
What would the protein look like?
Create a point mutation in the DNA and then give the mRNA and protein sequence.
Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

Expert Solution

a. 3' TTGAAGCCGAATTTACCTCCGGTA 5'

b. 5' AACUUCGGCUUAAAUGGAGGCCAU 3'

c. Asn - Phe - Gly - Leu - Asn - Gly - Gly - His

d. Mutation type - Silent point mutation

Template - AACTTTGGCTTAAATGGAGGCCAT

Complementary strand - TTGAAACCGAATTTACCTCCGGTA

mRNA - AACUUUGGCUUAAAUGGAGGCCAU

Protein - Asn - Phe -Gly - Leu - Asn - Gly - Gly - His

e. Template - AACTTTGGCTTAAATGGAGGCCAT

mRNA - AACUUUGGCUUAAAUGGAGGCCAU

Protein - Thr - Leu - Ala - Stop - Met - Glu - Ala

gladiator answered 1 year ago

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

learn how to find the nucleotide sequence of the complementary DNA STRAND

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence? If you have an RNA transcript that is 100 bp, how many codons does it contain? If you take the template DNA that is shown in question 1 and you mutate the 6thnucleotide from A to G how does that impact the polypeptide sequence Is it better to have a mutation...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes. How many DNA fragments will you get? D) You choose to cut...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of DNA (below), write the sequence of the complementary strand indicating the appropriate 5' and 3 " ends.

Question