class discussions about categories of biochemical molecules

Make the assumption that a cell has a 10% salt concentration inside its cytoplasm. What factors do you think would influence the rate of diffusion?

vegetative bacterial cells will be killed at _______Centigrade in ______ minutes

How do prokaryotic cells exhibit cellular differentiation? Describe one manner of differentiation and the purpose of such differentiation.

In the lecture on eugenics, we came across the ideas of both positive and negative eugenics. Do you think positive eugenics can achieve the stated goal of improving the quality of our society? Why, or why not? In your answer, be sure to reference the related concepts we covered in the course. Your response should demonstrate your understanding of the principles of inheritance and evolution.

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

What is science, and how do we use it to solve real-world problems? What is science, and what is biology in particular?

Does freezing influence the stability of mayonnaise? Why?

ANSWER ALL QUESTIONS DON'T ANSWER IF YOU CANT ANSWER ALL I NEED THEM WELL EXPLAINED THANKS

Define perimenopause, surgical menopause, stress menopause, and postmenopause. What are the signs of menopause? What other life changes may influence a women's experience during menopause? Describe women at the highest risk for osteoporosis. Describe the traditional and alternative therapies for the conditions associated with menopause. Design a health, nutrition, and exercise program for middle-aged and older adults

Assume chromosome 1 has the following structure: A B centromere C D E F G What could be the result of a pericentric inversion? Where should the chromosome break to obtain this aberration?

Briefly explain how a medical diagnostic test kit based on gold nanoparticles works. Pitch your answer at the level of a scientifically-literate audience that are not physicists. (A diagram could be useful)

Photosynthesis and Chemosynthesis are unique, but also similar. Discuss each of their unique properties and similarities. Are cyanobacteria more plant or animal? Discuss. What makes these organisms special?

what prevents electrons from flowing in reverse during electron transport after being dropped off by the electron carriers

Discuss the actions taken by prokaryotes when energy substrate conditions and availability concentrations are: 1. glucose present lactose absent, 2. Glucose absent and lactose present, 3. Glucose high and lactose low. Be sure to describe the complete mechanism responsible for the metabolic switch from glucose to lactose metabolism and any factors associated with that change