Questions
which of the following statements is/are true concerning non competitive (allosteric) inhibition a. binding of the...

which of the following statements is/are true concerning non competitive (allosteric) inhibition

a. binding of the inhibitor to the regulatory (allosteric) site reduces the activity of the enzyme
b. binding if the substrate to the active (substrate) site prevents binding of the inhibitor to the allosteric site
c. it often occurs when the product(s) of a biochemical pathway accumulate
d. all of the above
e. A and C

In: Biology

ANSWER ALL QUESTIONS DON'T ANSWER IF YOU CANT ANSWER ALL I NEED THEM WELL EXPLAINED THANKS...

ANSWER ALL QUESTIONS DON'T ANSWER IF YOU CANT ANSWER ALL I NEED THEM WELL EXPLAINED THANKS

Define perimenopause, surgical menopause, stress menopause, and postmenopause. What are the signs of menopause? What other life changes may influence a women's experience during menopause? Describe women at the highest risk for osteoporosis. Describe the traditional and alternative therapies for the conditions associated with menopause. Design a health, nutrition, and exercise program for middle-aged and older adults

In: Biology

Assume chromosome 1 has the following structure: A B centromere C D E F G What...

Assume chromosome 1 has the following structure: A B centromere C D E F G What could be the result of a pericentric inversion? Where should the chromosome break to obtain this aberration?

In: Biology

Briefly explain how a medical diagnostic test kit based on gold nanoparticles works. Pitch your answer...

Briefly explain how a medical diagnostic test kit based on gold nanoparticles works. Pitch your answer at the level of a scientifically-literate audience that are not physicists. (A diagram could be useful)

In: Biology

Photosynthesis and Chemosynthesis are unique, but also similar. Discuss each of their unique properties and similarities....

Photosynthesis and Chemosynthesis are unique, but also similar. Discuss each of their unique properties and similarities. Are cyanobacteria more plant or animal? Discuss. What makes these organisms special?

In: Biology

what prevents electrons from flowing in reverse during electron transport after being dropped off by the...

what prevents electrons from flowing in reverse during electron transport after being dropped off by the electron carriers

In: Biology

Discuss the actions taken by prokaryotes when energy substrate conditions and availability concentrations are: 1. glucose...

Discuss the actions taken by prokaryotes when energy substrate conditions and availability concentrations are: 1. glucose present lactose absent, 2. Glucose absent and lactose present, 3. Glucose high and lactose low. Be sure to describe the complete mechanism responsible for the metabolic switch from glucose to lactose metabolism and any factors associated with that change

In: Biology

PCR Practice: Create forward and reverse primers that amplify the majority of the sequence below. Draw...

PCR Practice:

Create forward and reverse primers that amplify the majority of the sequence below. Draw circles around the section of the sequence your primers are taken from. Highlight the region of the sequence that your PCR will amplify. Indicate the 3’ and 5’ ends on your primers.

>gi|297828897|ref|XM_002882285.1| Arabidopsis lyrata subsp. lyrata glyceraldehyde-3-phosphate dehydrogenase C subunit (GAPC), mRNA

CTCCACGTTCTTCTCTCTTTTAAATAGACCCTTCACGGACCCTTCTCACTCACCTATCTCACTGTTAAAT

ATCTCTCTGTGAATCTCATCTTCAACCTCTCTTACACACTCGCGTTTTCGATTCAAACAATGGCTGACAA

GAAGATTAAGATCGGAATCAACGGATTCGGAAGAATCGGTCGTTTGGTTGCTAGAGTTGTTCTTCAGAGG

GACGATGTTGAGCTCGTTGCTGTTAACGACCCCTTCATCACCACTGAGTACATGACCTACATGTTCAAGT

ATGACAGTGTTCACGGTCAATGGAAACACAATGAACTCAAGATCAAGGATGAGAAGACCCTTCTCTTCGG

TGAGAAGCCAGTCACTGTTTTCGGCATCAGGAACCCTGAGGATATCCCATGGGCCGAGGCTGGAGCTGAC

TACGTTGTTGAGTCTACCGGTGTCTTCACTGACAAGGACAAGGCTGCTGCTCACTTGAAGGGTGGGGCCA

AGAAGGTTGTCATCTCTGCCCCCAGCAAAGACGCACCCATGTTTGTTGTTGGTGTCAACGAGCACGAATA

CAAGTCCGACCTTGACATTGTCTCCAACGCTAGCTGCACCACTAACTGCCTTGCTCCCCTTGCCAAGGTT

ATCAACGACAGGTTTGGAATTGTTGAAGGTCTTATGACAACAGTCCACTCTATCACTGCTACTCAGAAGA

CTGTTGATGGTCCATCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTCAACATTATTCCCAGCAG

CACTGGAGCTGCCAAGGCTGTCGGAAAGGTGCTTCCAGCCCTTAACGGAAAGTTGACCGGAATGTCTTTC

CGCGTCCCAACCGTTGATGTCTCAGTTGTTGACCTTACTGTCAGGCTCGAGAAAGCTGCTACCTATGATG

AAATCAAAAAGGCTATCAAGGAGGAATCTGAAGGCAAACTTAAGGGAATCCTTGGATACACCGAGGATGA

TGTTGTCTCAACTGACTTCGTTGGTGACAACAGGTCGAGCATTTTTGACGCCAAGGCTGGAATTGCATTG

AGCGACAAGTTTGTGAAATTGGTGTCATGGTACGACAACGAATGGGGTTACAGTTCCCGAGTGGTCGACT

TGATCGTTCACATGTCAAAGGCCTAAGCTAAGAAGCAGATCTCGAACGGCGAGGAGTGGAAAGTCATCTG

TTCATCCTCTTTTATGGTCTGACTTTGTCGTTTTCGAATAAAATTTCTTTGAACTTGGAACCCTTTTTTT

TTTTTTTTGGTTTTCTTAATTCTCATTCATGTGAGTTGATGGGAGTTTGTAGACCGGTGTTTTACTGAAG

CCCTTTCGTTTTTGGCTTTTGATATATTGAGTTACTTATGGTTTTTCATTTTGTTTCACTTCTCTTTTTT

TCTATATACTAAATCAAATCTGAACGAAC

Forward:_____________________________________________

Reverse:_____________________________________________

- Primers must be 18-30 base pairs in length

- Cannot contain intra-complementary sequences

- Must have a G-C clamp of 2-5 base pairs

- Also include GC content of primers and melting temperature


- Include number of nucleotides in primer

- G/C clamp- write out the G/C clamp in this format: 3' - GCC (whatever the G/C clamp is should go in the place of the GCC)

- Circle the template strand in the location the primers are taken from

In: Biology

Give reasons for the following a. Cytosine and guanine form three hydrogen bonds b. Addition of...

Give reasons for the following
a. Cytosine and guanine form three hydrogen bonds
b. Addition of acid to a DNA solution causes a change in its absorbance.
c. Adenosine is more soluble than adenine even though the latter is smaller
d. Guanosine monophosphate is acidic
e. The base pairing of DNA becomes disrupted at high pH.

In: Biology

Q1.Explain why the process of translation has been appropriately named. Q2. In What ways is the...

Q1.Explain why the process of translation has been appropriately named.

Q2. In What ways is the structure of mRNA similar to the DNA?How does mRNA differ from DNA?

In: Biology

6. View the first seven minutes of the following video: “Part 1: Genes that Control Aging”...

6. View the first seven minutes of the following video: “Part 1: Genes that Control Aging” by Dr. Cynthia Kenyon (iBioSeminars). If you would like to learn more about Dr. Kenyon’s research, please feel free to view the entire video! Note: You may copy and paste the link for the video directly into the address bar of your browser: https://youtu.be/DT4PWu43e9U

Then answer the following question:

1.a. What critical observations did Dr. Kenyon’s initial hypothesis explain?

1.b. What was Dr. Kenyon’s initial hypothesis?

1.c. How did Dr. Kenyon and her colleagues test the hypothesis using C. elegans?

1.d. What were their key observations regarding daf-2?

1.e. What conclusions did the observations support?

In: Biology

What is the effect on aviation fuels production? What is the effect on aviation fuels consumption?...

What is the effect on aviation fuels production?

What is the effect on aviation fuels consumption?

Please answer into details and include diagrams if necessary. Include references if you have used any.

no extra info. I need what effect could happen when we produce and consuen aviation fuels?

In: Biology

Identify any unique characteristics of the Trophosphere: Select one or more: a. clouds, rain, winds and...

Identify any unique characteristics of the Trophosphere:

Select one or more:

a. clouds, rain, winds and storms all occur in this sphere

b. comprised of mostly water vapor

c. is the weather and climate zone

d. greenhouse effect caused by heat trapping gases present in small concentrations

e. nitrogen and oxygen gasses are in the highest concentrations

f. ozone layer exists here

In the Nitrogen cycle, which organisms specifically fix nitrogen gas (N2) from the atmosphere?

Select one:

a. bacteria in the root nodules of legume plants

b. decomposers

c. soil bacteria

d. A and C

e. B and C

Refer to the following equation:   Sugar (Glucose) + O2 + H20 --> CO2 + H2O + ATP

Select one:

a. this represents photosynthesis

b. this represents cellular respiration

c. organisms use to produce energy molecules necessary for metabolic reactions

d. A and C

e. B and C

In: Biology

Ch. 3: Molecular diversity Relate the structure of each macromolecule with its function Contrast the structure...

Ch. 3: Molecular diversity

  • Relate the structure of each macromolecule with its function
  • Contrast the structure of DNA and RNA
  • Describe the levels of protein structure and how each level is determined
  • Explain the link between protein structure and protein function
  • Explain what is denaturation and why it affects protein function
  • Explain the structure of lipids and relate it to their function

In: Biology

Chapter 7: How Cells Harvest Energy Interpret the role of electrons, electron carriers, and ATP in...

Chapter 7: How Cells Harvest Energy

  • Interpret the role of electrons, electron carriers, and ATP in energy metabolism
  • Explain the purpose of oxygen in respiration
  • Describe where in the cell and where in mitochondria each process of cellular respiration happens
  • Summarize the initial reactants, final products and outcomes of glycolysis, pyruvate oxidation and Krebs cycle. In this summary, track the carbons, the electrons and the ATP produced.
  • Illustrate the purpose of the electron transport chain, where those electrons come from and where do they end up.
  • Contrasts the two mechanisms for producing ATP and their relative efficiency.
  • Distinguish the process and the outcomes between aerobic and anaerobic respiration

In: Biology