Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in the cytoplasm: Select one:
a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b. 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’ GCUAUAACGUGGAAAAAAAAAA 3’ d. 3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’
In: Biology
What is your favorite food? Use proper terms to describe its sensory aspects. Which sensory attributes agrees with your taste? Which sensory attributes do you use to judge the quality of this food? What sensory aspects in this food can tell if this food has gone bad? You can use pictures to support your answer.
In: Biology
1. Describe how attaching an enzyme to the cell membrane regulates the rate of a specific reaction
2. Describe the type of reaction that is typically regulated by an allosteric enzyme based on DG for the reaction.
3. Differentiate between positive and negative feedback loops based on sequence of reactions resulting the formation of a final product, “F”
4. Differentiate between the [S] that gives half maximum velocity based on an allosteric enzyme without and with an allosteric activator
In: Biology
Question 30:
A. Describe the secondary structural characteristics of B-form double-stranded DNA.
B. Explain how to determine the number of supercoils present in a molecule of DNA.
C. Explain/demonstrate how to determine changes in linking number for DNA.
In: Biology
Topic : recent advance in Genetics ( write a review on it more than 800 words) Please answer the question only if you can observe the minimum limit of 800 words. Thank you
In: Biology
What is the main purpose of chromosome pairing in meiosis I?
Group of answer choices
For crossing over to occur
For proper chromosome segregation to occur
For mitosis to occur
Flag this Question
Question 291 pts
Male bees are haploid. How do they produce gametes?
Group of answer choices
By mitosis
By meiosis
Flag this Question
Question 301 pts
Which of the following determines the correct segregation of X and Y chromosomes during meiosis I in humans (males):
Group of answer choices
Lack of homology between X and Y
Presence of “pseudoautosomal” (PAR) regions shared by X and Y
The presence of the SRY gene
In: Biology
Answer the following questions in at least two paragraph (Be as descriptive as possible)
Compare the structure of DNA and RNA. Explain how the structure of tRNA correlates to its function? Discuss any versatility or redundancy that is present?
In: Biology
When a heterozygous Aa diploid cell undergoes mitosis, what are the genotypes of the mitotic products?
Group of answer choices
Aa (product 1) and Aa (product 2)
AA (product 1) and aa (product 2)
AA (product 1) and AA (product 2)
aa (product 1) and aa (product 2)
When a heterozygous Aa diploid cell undergoes the 1st meiotic division (meiosis I), how will the A and a alleles distribute to the two meiosis I products if there is no crossing over?
Group of answer choices
Aa (product 1) and Aa (product 2)
AA (product 1) and aa (product 2)
AA (product 1) and AA (product 2)
aa (product 1) and aa (product 2)
According to Mendel’s principle of segregation, an Aa heterozygous diploid organism produces:
Group of answer choices
Only gametes that are AA
Only gametes that are aa
AA and aa gametes in theoretically equal numbers
A and a gametes in theoretically equal numbers
According to Mendel’s principle of independent assortment, a diploid organism with the genotype Aa Bb (the genes are located on different chromosomes) produces:
Group of answer choices
Only Ab and aB gametes
Only ab and AB gametes
AB, Ab, aB, and ab gametes
If allele A confers the A+ phenotype, and allele a is recessive (aa has A- phenotype), what will the A+ : A- ratio be among the offspring of an Aa X Aa cross?
Group of answer choices
1A+ : 1A-
1A+ : 3A-
3A+ : 1A-
4A+ : 0A-
In: Biology
Why is the interconnectedness of the brain critical to higher order function?
In: Biology
What do both G protein-coupled receptors and tyrosine kinase receptors have in common?
|
The binding site for the signaling molecule is located on the outside of the cell. |
||
|
They both interact with G proteins. |
||
|
Binding of the signaling molecule forms a dimer. |
||
|
They both result in a phosphorylation cascade. |
In: Biology
A chromosomally XY fetus with normally functioning testes has a mutation in the androgen receptor so it can't respond to testosterone (but it can still respond to MIS). Which of the following WILL develop by the time the child is born?
Select one:
a. A uterus
b. Fallopian tubes
c. A cletoris
d. An epididymis
What important difference appears to explain why some species form pair bonds and others don't?
Select one:
a. Species differences in the size of the nucleus accumbens
b. Species differences in the number and/or distribution of oxytocin and vasopressin receptors in the brain
c. Species differences in the circulating concentrations of oxytocin and vasopressin
In: Biology
In: Biology
Can you please explain the molecular components involved in the pathway of SsrA-tagged protein degradation in Vivo? Including the adaptor protein SspB and delivery to ClpX and subsequent degradation by ClpP.
In: Biology
BIO REVIEW SHEET 4
In: Biology
The list below describes (in no particular order) some early events of the pre-embryonic period.
1 – Cortical reaction
2 – Blastocoel forms
3 – Yolk sac and amnion start to form
4 – Dichorionic-Diamnionic twins
5 – Four celled pre-embryo
6 – Human chorionic gonadotropin present in urine
The 6 steps above are not in the correct order.
In: Biology