In: Biology
1. The active site of an enzyme usually consists of a pocket on the enzyme surface lined with the amino acid side chains necessary to bind the substrate and catalyze its chemical transformation. Carboxypeptidase, which sequentially removes the carboxyl-terminal amino acid residues from its peptide substrates, consists of a single chain of 307 amino acids. The two essential catalytic groups in the active site are furnished by Arg145 and Glu270 .
a. How many amino acid residues apart are these two amino acids?
b. Explain how it is that these two amino acids, so distantly separated in the sequence, can catalyze a reaction occurring in the space of a few tenth of a nanometer?
c. If only these two catalytic groups are involved in the mechanism of hydrolysis, why is it necessary for the enzyme to contain such a large number of aa residues?
2. What level of protein structure would be disrupted by the following below
a. heat
b. strong acid
c. saturated salt solution
d. organic solvents such as alcohol and chloroform
In: Biology
Three plant genes, A, B, and C, are linked and occur in the following order. Genetic distances are given as map units (m.u.):
A________10 m.u.______B_____0 m.u.__C
The genes underlie the following phenotypes:
A/_ = blue flowers, a/a = white flowers
B/_ = tall stems, b/b = short stems
C/_ = green leaves, c/c = red leaves
You cross two individuals with the following genotypes:
AbC/AbC x aBc/aBc
You testcross the resulting F1. The proportion of offspring that will have blue flowers is _
In: Biology
My biology teacher has asked this question: "what happen to firmness of the Jello if you add no sugar comparing to adding 3, 6, and 9 teaspoons of sugar? What will be the results in the 4 Jello products?" Thanks in advance.
In: Biology
Topic: Protein interaction and phase separation (Subject: Functional Genomics and Bioinformatics)
Please answer both Part A and B if possible, IF NOT PRIORITISE ON PART B
Consider the following scenario. A mutation in gene M was discovered to be a highly penetrant risk factor for disease P. There is no information on what the function of gene M is or what other proteins the gene product of M interacts with. All that is known is that M is abundantly and ubiquitously expressed in all cell types.
A. Describe in detail one (1) experimental approach that can be used for defining what proteins bind to gene product M and how the mutation alters the binding partners.
B. If purified gene product M were found to phase separate into droplets in a test tube, describe an experiment that that would distinguish whether the protein was in a liquid state or a glassy or fibrillar state.
In: Biology
What does it mean to travel down a concentration gradient? Would it take longer for a cell to get oxygen to the middle of the cell via diffusion if it had a higher or lower surface area? Why?
In: Biology
How many sugars ar needed to provide the energy and construction material fro making a new cell? Make an estimate for the average rate of sugar uptake for dividing bacterium.
In: Biology
What approximate %T (Transmittance) do you think represents the normal physiological cell volume?
In: Biology
In: Biology
If you wanted to inhibit neutrophile accumulation at the site of an infection, What mechanism(s) that promote neutrophile accumulation would you target and why?
In: Biology
SUMMARY
This discussion is prompted by two articles. The first article entitled “Genetic variation in chromosome Y regulates susceptibility to influenza A virus infection” by Krementsov et al. introduces the genetic components of human susceptibility to Influenza A virus. The second paper by Lindor et al discusses questions surrounding the increasing genome sequencing information available to healthy individuals.
Several issues arise from the availability of detailed health information including concerns about discrimination and stigmas, as well as the impact on the psychological well-being of those found to be at increased risk for infections, diseases, or conditions. Such sensitive health information also poses ethical, legal, and social challenges for the management of such information (who has access, who is allowed to view such information). The applications of personalized genome information require care and expertise in interpreting genetic data and implementing, for example, changes in lifestyle and behavior.
The background reading includes first, an article titled “Ethical Consequences of Full Human Genome Testing” which discusses privacy concerns over the handling of such genomic information (which may include the quality of individual responses to disease treatment, their health susceptibilities, predictions of their future disease likelihood, their carrier status for certain genetic disease alleles, etc.). Second, an issue brief regarding workplace wellness health screening programs and the rights of workers regarding this information titled “Changing Rules for Workplace Wellness Programs: Implications for Sensitive Health Conditions”.
DISCUSSION PROMPTS
In: Biology
Please write about these questions like a small paragraph answering he questions below:
Do you think that microbes can have cooperative traits? Why or why not?
Think about the RNA viruses that evolve as if they were playing the prisoner's dilemma game. What if you did not know about the prisoner's dilemma and you were given the data on fitness at different starting frequencies in the paper presented. How would you interpret those results? Is it useful to think about the data by thinking about the prisoner's dilemma? If this was a virus infecting a human, would you hope that the viruses defect or cooperate? Why? What might you do to try to encourage defection?What is the difference between group and individual selection? Do you think natural selection operates at the level of a group? Why? Why do some scientists think that is problematic? What is kin selection, and how is it expected to affect the persistence of cooperative traits?
How does spatial structure affect the stability of cooperation?
In: Biology
Sequence 1:
5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'
Sequence 2:
5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'
Design a splint oligomer and write the all-possible content(s)
needed for reaction to occur.
In: Biology
For the last several years scientists have fretted over the future of bees, and although research has shed much light on the crisis, there is still debate on the causes and costs of this issue. In no more than 500 words state your opinion on this topic.
In: Biology
Please illustrate the steps to recombinant cloning of the vector to express c-Myc-GFP-His6 in mammalian cells with detailed DNA sequences of primers. Please explain why the chosen particular vector was used and why the chosen version of the c-Myc gene was used.
In: Biology