Questions
1. What are the k-mers of length k = 21 for this sequence read in FASTQ...

1. What are the k-mers of length k = 21 for this sequence read in FASTQ format?

@K000384:75:HM57CBBXX:1:1101:25530:1384 1:N:0:GTGGCC

CTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT

+

AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

[please be detailed, thanks]

In: Biology

Question 8.  A transmembrane protein uses a β barrel structure to span the cell membrane.  How can amino...

Question 8.  A transmembrane protein uses a β barrel structure to span the cell membrane.  How can amino acid mutations in a protein within this β barrel structure affect interactions with the membrane and why? (Up to 50 words)  

Question 9.  Haemoglobin is a protein that carries oxygen in our red blood cells.  Sickle cell anaemia is a genetic disease in which Glu at position 6 of haemoglobin is mutated to a Val, rendering haemoglobin non-functional.

  1. What type of amino acid change is this?  (1 mark)

  1. Give one reason why this could affect the function of this protein.  (1 mark)

Question 10.  Lectin is a protein that binds carbohydrates and is critical for biological recognition processes in living organisms.  Describe what bonds and forces could be involved in lectin and carbohydrate interactions. (Up to 50 words)  

Question 11.  A hexokinase is an enzyme that adds a phosphate to glucose after it enters the cell, which is considered the first step of glycolysis.  One enzyme, hexokinase A (HKA), has a Km of 0.02 mM, whereas another, hexokinase B (HKB), has a Km of 1.0 mM.  Explain why some types of fast growing cancer cells would use HKA instead of HKB. (Up to 50 words)  

In: Biology

Describe how the “kidney” works in amphixous using the anatomical terms we discussed in lecture and...

Describe how the “kidney” works in amphixous using the anatomical terms we discussed in lecture and then a possible mechanism of how it may move materials from the blood

In: Biology

Describe the 3 major anatomical advances/adaptations that occurred in the vertebrates and explain how each added...

Describe the 3 major anatomical advances/adaptations that occurred in the vertebrates and explain how each added to its success and size increase

In: Biology

Differentiate between the three major phyla of bryophytes by identifying their defining characteristics

Differentiate between the three major phyla of bryophytes by identifying their defining characteristics

In: Biology

1) Describe the types of bacterial cell arrangements and how the different planes of cell division...

1) Describe the types of bacterial cell arrangements and how the different planes of cell division determine their arrangements. Why Bacilli are less varied in arrangement than cocci? 2) Mycoplasmas are classified as Low G + C Gram-Positive Bacteria in the textbook. However their staining phenotype indicates they are gram negative. What is the basis for classification as gram positive bacteria? 3) Make a dichotomous key to distinguish among the orders of Gammaproteobacteria

In: Biology

Why are Syngamy and meiosis processes in the life cycles of organisms ? What function do...

Why are Syngamy and meiosis processes in the life cycles of organisms ?
What function do you think the spores have in physarum?
How do myxamoebae aggregate?
How does a pseudoplasmodium differ from a true plasmodium? What function does the E. Cool have in the culture of dictyostelium?

In: Biology

The second PCR you perform requires that only 3-10ng of PCR product be used for ideal...

The second PCR you perform requires that only 3-10ng of PCR product be used for ideal results. This, of course, must be paired with careful lab technique, such as keeping the sequencing PCR mix ice-cold and not contaminating the reaction with outside sources of DNA such as that on your fingertips. The following steps will take you through a proper dilution of the PCR product so that you get the appropriate concentration of DNA for your sequencing reaction. Remember: you cannot pipet 0.5 µl or 1 µl with a P20 micropipettor. The lowest volume you can pipet is 2 µl. Attempting to set it lower than that can break the equipment!

As per the instructions on page 35 of your manual, you need to add:

4 µl of [PCR product + water] that has a total of 3-10ng of DNA

to the 0.2ml PCR tube that already contains 6 µl of the Big Dye Master Mix (=Sanger Sequencing PCR Mix) to get a 10 µl reaction.

If you need 3-10 ng/4 µl, what is the DNA concentration range per 1 µl required?

  

Many of you will have a band equally bright to the 500bp SS band, so go back to #3 in Step 1 and record that amount here:

______________ ng DNA/ µl PCR product

How many times higher is the concentration of DNA in #7 as compared to the concentration required per microliter (#6)?    [For example, if you had a sample that had 1500ng DNA/µl and you needed ~125ng DNA/µl, your sample would be 12x higher than it should be.]

To get DNA at the volume and concentration you need, use the # calculated in #8 to determine your proportion of sample:water. This diluted DNA would need to be mixed in an empty, separate tube and can be at any volume so long as the ratio is correct (though keep in mind you only have ~40 µl of PCR product remaining).

Using the example from #8, if we had a sample that was 12x more concentrated than required, we would make a dilution that was 1/12 sample and 11/12 water. This would be a 1:11 ratio. Since the minimum volume we can accurately pipet is 2µl, we could make a tube with 2µl sample (=3000ng DNA) and 22µl water = total of 3000ng DNA/24µl water = 125ng/µl.   4µl of this diluted DNA could then be pipetted out and added to the desired reaction.

Work with your partner to determine how to make a DNA dilution that would be appropriate for sequencing, yielding at least 4µl total volume containing only 3-10ng DNA. Again, your minimum pipetting volume is 2µl.   

In: Biology

What properties of ions and their respective transmembrane channels make K+ channels selective for a specific...

What properties of ions and their respective transmembrane channels make K+ channels selective for a specific ion? (Hint: focus on pore and the selectivity filter).

In: Biology

Researchers have identified a gene that, they think, encodes a voltage-dependent potassium channel. How would you...

Researchers have identified a gene that, they think, encodes a voltage-dependent potassium channel. How would you go about trying to prove that it does encode such a channel?

In: Biology

1 Explain the meaning of the term mutarotation. 2 Draw the structure of a disaccharide made...

1 Explain the meaning of the term mutarotation.

2 Draw the structure of a disaccharide made up of two D-glucose units. The glycosidic bond is

    α-1,6-glycosidic bond.

3 Trehalose is a disaccharide that can be obtained from fungi, sea urchins and insects. Acid hydrolysis of

    trehalose yields only D-glucose. Trehalose is hydrolysed by α-glucosidase and not by β-glucosidase

    enzymes. Methylation of trehalose followed by hydrolysis yields two molar equivalents of

    2,3,4,6-tetra-O-methyl-D-glucopyranose.

  1.   From the following experimental data, deduce the structure of trehalose.
  2. What will be the effect of trehalose on Fehling’s solution?

4(a) Suggest a test you will use to show that a given food substance contains protein.

  1. Show how you will use
  1. Modified Gabriel’s Synthsis
  2. Streckers’s Synthesis   to prepare phenylalanine in the laboratory.

5 (a) Describe in detail how you will determine the primary structure of protein.

(b) You have been given a mixture of lysine, histidine and cysteine. The isoelectric point of the amino acids are as follows:

Histidine                        7.64

Lysine                             9.74

Cystenie                         5.02

Show how you will separate the mixture into the pure forms. State and describe any instrument that you will use to separate the components in the mixture.

6 (a) A decapeptide has the following amino acid composition:

         Ala2 , Arg, Cys, Glu, Gly, Leu, Lys, Phe, Val

       Partial hydrolysis yields the following tripeptides:

       Cys-Glu-Leu + Gly-Arg-Cys + Leu-Ala-Ala+ Lys-Val-Phe + Val-Phe-Gly.

       Reaction of the decapeptide with 2,4-dinitrofluorobenzene yields 2,4-dinitrophenylysine. From the

       experimental data, deduce the primary structure of the decapeptide.

   (b) Suggest a scheme you will follow to synthesize the dipeptide Ala-Gly

In: Biology

With the aid of a simple generic diagram, identify and explain how the type(s) of chemical...

With the aid of a simple generic diagram, identify and explain how the type(s) of chemical bonding stabilizes a secondary structure that is present in crystal structure of Yeast Hexokinase PII with the correct amino acid sequence

In: Biology

I can ferment glucose and can grow in anaerobic environment via fermentation of this sugar. I...

I can ferment glucose and can grow in anaerobic environment via fermentation of this sugar. I also produce purple color in a microbiological test to which oil is added to stimulate the formation of anaerobic environment.

  1. What is the substrate of the enzyme, the presence or absence of which will determine whether the test, with the purple color, will be positive or negative

a) glucose            b) amino acid(s)               c) protein                      d) lipids

  1. What is the indicator of the test media from question 13.

a) amylase    b) methyl green    c) ferric ammonium citrate    d) bromcresol purple     e) iron

  1. What is the nature of the chemical reaction catalyzed by this enzyme?

a) hydrolysis of nucleotides                                   b) hydrolysis of proteins

c) decarboxylation of amino acids                        d) deamination of amino acids

I can not grow in a viscous environment. I don’t have DNAse.

  1. What will be the color of the growth around me, if I lack these skills?

a) colorless       b) green              c) red                      d) black

  1. I can remove amine groups from amino acids such as phenylalanine. What will be the color associated with my growth after the addition of the appropriate indicator?

a) colorless                b) green               c) red                           d) black

  1. I am a test where no indicator is needed. I am whitish in color to begin with and when bacteria that grows on me makes the right enzyme, you could see a halo around its growth. What is my name?

a) lipase test                 b) Glucoronate test                 c) amylase test                         d) casease test

In: Biology

Time Genus Species Cranial Capacity Important Features World Locations/Comments Ardipithecus Ramidus vs Orrorin vs Sahelanthropus (Toumai)...

Time

Genus

Species

Cranial Capacity

Important Features

World Locations/Comments

Ardipithecus

Ramidus vs Orrorin vs Sahelanthropus

(Toumai)

Australopithecus

anamensis

Australopithecus

afarensis

Australopithecus

africanus

garhi

Paranthropus

(australopithecus in our Larsen text)

aethiopicus

robustus

boisei – nutcracker man

Homo

habilis

(Early Homo)

Homo

Erectus

(sometimes you hear Homo ergaster as an early version but this is going away)

Homo

neanderthalensis

Homo

sapiens

(Anatomically Modern Human)

Homo

floresiensis

In: Biology

Take a recent drug advertisement from a journal and retrieve 2 journal references mentioned in the...

Take a recent drug advertisement from a journal and retrieve 2 journal references mentioned in the advertisement to determine if the truly support the claim in the ad ( see medscape.com/viewarticle/726442 for ideas to look for)

In: Biology