Eastern diamondback rattlesnake venom contains high levles of Phospholipase A2, this catalyzes the breakdown of the second of the three (C-2 position) lipid groups of glycerophospholipids. Though the high levels of phospholipase A2 in venom can be deadly, this enzyme is necessary for a variety of normal metabolic processes. What problem(s) does excess of this enzyme cause, by hydrolyzing these bonds? And what are the normal metabolic processes that phospholipase A2 is used for?
In: Biology
1. Identify and select any topic of your interest
related to public health or health informatics, for
approval
2. List down your study question, study goal, and
study specific objectives, for approval
3. Why you have selected this topic and why it is
important? what are its scopes in health
4. Give a brief introduction of your research topic
along with its key terms
Please attach the cover sheet to you your
assignment
Examples of previous students work,
1. Privatization of hemodialysis centers improves
health care for kidney patients: insight from ministry of health in
Saudi Arabia
2. Uses of smokeless tobacco and associated health
effects among adults in southern region of Saudi Arabia: cross
sectional study.
subject must be from Saudia Arabia
In: Biology
Which of the following macromolecules would yield only one type of monomer after complete hydrolysis?
A. DNA
B. Glycogen
C. Lipoprotein
D. RNA
E. Triacylglycerol
The answer is B but can someone explain why that is the answer and
the others are wrong?
In: Biology
Cloning is a major topic of debate. Briefly describe the process of cloning in the lab incorporating facts.
How is cloning involved in gene therapy?
Give a specific and detailed example of how gene therapy may be used to solve problems associated with genetic disorders. Discuss the benefits and possible hazards of gene therapy to human health.
What might be the benefits of cloning? What are potential dangers or threats associated with the widespread use of cloning? Discuss the ethics of cloning in its various proposed forms and uses. Discuss how cloning is related to GMOs.
In: Biology
Make a table listing the four major challenges to plants living on land. In the second column, list at least one plant adaptation for each challenge.
In: Biology
In: Biology
1. Suzie was curious about how productive college sophomores attending Penn State Main campus are in working on a math worksheet when listening to music. She decided to conduct an experiment. She picked five of her closest sophomore friends to participate. She had each of them bring a phone and headphones to listen to music. She gave them all a copy of the same calculus worksheet to work on and timed how long it took them to finish it correctly.
a. List three things wrong with Suzie’s experiment.
2. Explain the difference between a independent variable and a dependent variable. a. Provide an example of each in contexts of an experiment.
3. Give two reasons why ratio measurement is the best measurement system.
4. Define a random sample and convenience sample.
In: Biology
How is glycogen synthesis and breakdown a) reciprocally regulated to prevent the formation fo a futile cycle? and b) hormonally regulated to increase the supply of available ATP during times of stress?
In: Biology
MacConkey agar is selective and differential. Explain why they are selective and differential, and what is in the media that enables this to occur.
What results would you expect from plating the following microorganisms on MacConkey, and why?
A) Staphylococcus aureus
B) Serratia marcescens
C) Escherichia coli
In: Biology
- In what ways might algae benefit other organisms in the water?
- In what ways might algae harm other organisms?
- Suppose you are responsible for "cleaning up" a lake that is polluted with algae. What would you do, and why?
In: Biology
What component of the foraging process best explains the differences you see between the functional response of the predator on each of the prey types?
In: Biology
What kinds of materials obtained from a crime scene might contain DNA? (2 pts)
Consider the following DNA molecule
5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ
3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ
How many bp is the original fragment? (1 point)
The enzyme HaeIII has the following restriction site 5ʹ GG˅CC 3ʹ
3ʹ CC˄GG 5ʹ
If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point)
If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point)
Consider the following DNA molecule
5ʹ ATTCGCGAATTCGGTACCGAATTGGCAGATTCGCCGAATTCCCGTACGGAATTAGTTAAC 3ʹ
3ʹ TAAGCGCTTAAGCCATGGCTTAACCGTCTAAGCGGCTTAAGGGCATGCCTTAATCAATTG 5ʹ
How many bp is the original fragment? (1 point)
(Recognition site for EcoRI is given previously)
If digested with EcoRI, how many fragments are formed if the DNA is linear? (1 point)
If digested with EcoRI, how many fragments are formed if the DNA is circular? (1 point)
Using the results from question #2 (for linear DNA), draw the results on a gel( “—“ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)
A B
In: Biology
What is the relationship between a specimen's total body water (TBW) and the habitat it lives in?
In: Biology
In: Biology
Short Answer
As we have been learning during the semester all microorganism are unique and may have the ability to increase its pathogenicity dependent on the environment. This week we were introduced to hydrolytic enzymes, list two enzymes (enzymatic activity of Casease, enzymatic activity of Gelatinase) and their function. Using your critical thinking, explain why it is of importance to identify microorganism that have hydrolytic abilities.
The two anzymes is (enzymatic activity of Casease, enzymatic activity of Gelatinase)
In: Biology