How many mass extinction of species are there on records since the origin and diversification of life on earth? How is the present episode different? What is the result of loss of biodiversity in a region?
In: Biology
Briefly mention about—
(a) Genetic diversity,
(b) Species diversity,
(c) Ecological diversity.
In: Biology
Briefly mention about—
(a) Genetic diversity,
(b) Species diversity,
(c) Ecological diversity.
In: Biology
Describe hormone activate receptors in detail
In: Biology
Briefly mention about—
(a) Genetic diversity,
(b) Species diversity,
(c) Ecological diversity.
In: Biology
There are many meteorological (natural) events affecting the
behavior of air pollutants. Describe two conditions that produce or
enhance air pollution events. Please cite specific instances.
There are also conditions which help to disperse air pollutants.
Describe two of these conditions and how they affect the
environmental fate of chemicals. Essay form
Please
In: Biology
What is obesity?
How to prevent obesity?
prepare a balance diet plan fro yourself that meets your daily
requirements?
In: Biology
List some preventive and control measures for students regarding alcohol and drugs abuse.
In: Biology
List some preventive and control measures for students regarding alcohol and drugs abuse.
In: Biology
List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers who take it intravenously may cause
In: Biology
Which type of organ is spleen? What is its role and function in the body?
In: Biology
Given the DNA sequence matrix below:
Fern AGCCCAGGCTTCGAATGTCC
Pine AGCTTCAGTGTCGCACTTCC
Oak AGCTTCAGCGTCACACATCC
Moss AACCTTGGTGTCAAACGTCC
1. Assuming that Moss is the outgroup, draw all three possible
trees of evolutionary
relationships among these species. Label your trees A, B, and
C.
2. Sum up the number of differences between the DNA sequences for
all pairs of species
(There are 6 total pairs of species to be compared). Based on these
values, which tree (A,
B, or C) do you think is best under the Genetic Distance
criterion?
3. Determine the minimum number of mutations required under the
parsimony criterion for
each of the three trees. Which is the most parsimonious tree?
In: Biology
What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.
In: Biology
Which type of organ is spleen? What is its role and function in the body?
In: Biology
How is a cancerous cell different from a normal cell?
In: Biology