Questions
How many mass extinction of species are there on records since the origin and diversification of...

How many mass extinction of species are there on records since the origin and diversification of life on earth? How is the present episode different? What is the result of loss of biodiversity in a region?

In: Biology

Briefly mention about— (a) Genetic diversity, (b) Species diversity, (c) Ecological diversity.

Briefly mention about—

(a) Genetic diversity,

(b) Species diversity,

(c) Ecological diversity.

In: Biology

Briefly mention about— (a) Genetic diversity, (b) Species diversity, (c) Ecological diversity.

Briefly mention about—

(a) Genetic diversity,

(b) Species diversity,

(c) Ecological diversity.

In: Biology

Describe hormone activate receptors in detail

Describe hormone activate receptors in detail

In: Biology

Briefly mention about— (a) Genetic diversity, (b) Species diversity, (c) Ecological diversity.

Briefly mention about—

(a) Genetic diversity,

(b) Species diversity,

(c) Ecological diversity.

In: Biology

There are many meteorological (natural) events affecting the behavior of air pollutants. Describe two conditions that...

There are many meteorological (natural) events affecting the behavior of air pollutants. Describe two conditions that produce or enhance air pollution events. Please cite specific instances.
There are also conditions which help to disperse air pollutants. Describe two of these conditions and how they affect the environmental fate of chemicals. Essay form Please

In: Biology

What is obesity? How to prevent obesity? prepare a balance diet plan fro yourself that meets...

What is obesity?
How to prevent obesity?
prepare a balance diet plan fro yourself that meets your daily requirements?

In: Biology

List some preventive and control measures for students regarding alcohol and drugs abuse.

List some preventive and control measures for students regarding alcohol and drugs abuse.

In: Biology

List some preventive and control measures for students regarding alcohol and drugs abuse.

List some preventive and control measures for students regarding alcohol and drugs abuse.

In: Biology

List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug...

List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers who take it intravenously may cause

In: Biology

Which type of organ is spleen? What is its role and function in the body?

Which type of organ is spleen? What is its role and function in the body?

In: Biology

Given the DNA sequence matrix below: Fern AGCCCAGGCTTCGAATGTCC Pine AGCTTCAGTGTCGCACTTCC Oak AGCTTCAGCGTCACACATCC Moss AACCTTGGTGTCAAACGTCC 1. Assuming...

Given the DNA sequence matrix below:

Fern AGCCCAGGCTTCGAATGTCC
Pine AGCTTCAGTGTCGCACTTCC
Oak AGCTTCAGCGTCACACATCC
Moss AACCTTGGTGTCAAACGTCC

1. Assuming that Moss is the outgroup, draw all three possible trees of evolutionary
relationships among these species. Label your trees A, B, and C.


2. Sum up the number of differences between the DNA sequences for all pairs of species
(There are 6 total pairs of species to be compared). Based on these values, which tree (A,
B, or C) do you think is best under the Genetic Distance criterion?


3. Determine the minimum number of mutations required under the parsimony criterion for
each of the three trees. Which is the most parsimonious tree?

In: Biology

What is vaccination? What is the role of vaccines in body? Give two examples when immediate...

What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.

In: Biology

Which type of organ is spleen? What is its role and function in the body?

Which type of organ is spleen? What is its role and function in the body?

In: Biology

How is a cancerous cell different from a normal cell?

How is a cancerous cell different from a normal cell?

In: Biology