Explain the Socratic Method. What would be some merits and some problems that accompany this dialectic?
In: Nursing
HOW STARBUCKS USES PRICING
STRATEGY FOR PROFIT
MAXIMIZATION
|
In January 2020, Starbucks raised their beverage prices by an average of 1% across the U.S, a move that represented the company’s first significant price increase in 18 months. I failed to notice because the price change didn’t affect grande or venti (medium and large) brewed coffees and I don’t mess with smaller sizes, but anyone who purchases tall size (small) brews saw as much as a 10 cent increase. The company’s third quarter revenue rose 25% to $417.8 million from $333.1 million a year earlier, and green coffee prices have plummeted, so what gives? |
|
Starbucks claims the price increase is due to rising labor and non-coffee commodity costs, but with the significantly lower coffee costs already improving their profit margins, it seems unlikely this justification is the true reason for the hike in prices. In addition, the price hike was applied to less than a third of their beverages and only targets certain regions. Implementing such a specific and minor price increase when the bottom line is already in great shape might seem like a greedy tactic, but the Starbucks approach to pricing is one we can all use to improve our margins. As we’ve said before, it only takes a 1% increase in prices to raise revenues by an average of 11%. |
Value Based Pricing Can Boost Margins
For the most part, Starbucks is a master of employing value based pricing to maximize profits, and they use research and customer analysis to formulate targeted price increases that capture the greatest amount consumers are willing to pay without driving them off. Profit maximization is the process by which a company determines the price and product output level that generates the most profit. While that may seem obvious to anyone involved in running a business, it’s rare to see companies using a value based pricing approach to effectively uncover the maximum amount a customer base is willing to spend on their products. As such, let’s take a look at how Starbucks introduces price hikes and see how you can use their approach to generate higher profits.
An Overview of the Starbucks Pricing
Strategy:
The Right Customers and the Right Market
While cutting prices is widely accepted as the best way to keep customers during tough times, the practice is rarely based on a deeper analysis or testing of an actual customer base. In Starbucks’ case, price increases throughout the company’s history have already deterred the most price sensitive customers, leaving a loyal, higher-income consumer base that perceives these coffee beverages as an affordable luxury. In order to compensate for the customers lost to cheaper alternatives like Dunkin Donuts, Starbucks raises prices to maximize profits from these price insensitive customers who now depend on their strong gourmet coffee.
Rather than trying to compete with cheaper chains like Dunkin, Starbucks uses price hikes to separate itself from the pack and reinforce the premium image of their brand and products. Since their loyal following isn’t especially price sensitive, Starbucks coffee maintains a fairly inelastic demand curve, and a small price increase can have a huge positive impact on their margins without decreasing demand for beverages. In addition, only certain regions are targeted for each price increase, and prices vary across the U.S. depending on the current markets in those areas (the most recent hike affects the Northeast and Sunbelt regions, but Florida and California prices remain the same).
Product Versioning & Price Communication
They also apply price increases to specific drinks and sizes rather than the whole lot. By raising the price of the tall size brewed coffee exclusively, Starbucks is able to capture consumer surplus from the customers who find more value in upgrading to Grande after witnessing the price of a small drip with tax climb over the $2 mark. By versioning the product in this way, the company can enjoy a slightly higher margin from these customers who were persuaded by the price hike to purchase larger sizes.
Starbucks also expertly communicates their price increases to manipulate consumer perception. The price hike might be based on an analysis of the customer’s willingness to pay, but they associate the increase with what appears to be a fair reason. Using increased commodity costs to justify the price as well as statements that aim to make the hike look insignificant (less than a third of beverages will be affected, for example) help foster an attitude of acceptance.
on Wednesday April 8, Starbucks announced that it expects its fiscal second-quarter earnings to be cut nearly in half as the coronavirus pandemic causes sales to plunge in its two largest markets.
|
What is the type of Starbucks’ market? |
|
What are the main conditions of this market |
|
What is the shape of Starbucks’ demand curve? |
|
What is the degree of price elasticity of demand of Starbucks? Why? |
|
Did Starbucks make a good economic decision in raising the prices? Why? |
|
What are the Starbucks’ maximum profit conditions? |
|
What are the main three items groups that contribute to Starbucks variable costs? |
|
What would happen to Starbucks’ profit if the prices of all three go down, holding other things fixed? |
|
On Wednesday April 8, Starbucks announced that it expects its fiscal second-quarter earnings to be cut nearly in half as the coronavirus pandemic causes sales to plunge in its two largest markets. What would be the right pricing strategy to maximize revenues for Starbucks in the current circumstances? |
|
If you have your own business, what do you learn From Starbucks case study? |
In: Economics
For this assignment, we will learn to use Python's built in set type. It's a great collection class that allows you to get intersections, unions, differences, etc between different sets of values or objects.
1. Create a function named common_letters(strings) that returns the intersection of letters among a list of strings. The parameter is a list of strings.
For example, you can find the common letter in the domains/words statistics, computer science, and biology. You might easily see it, but you need to write Python code to compute the answer. In order to pass the tests you must use the set api.
In: Computer Science
Consider the cell described below at 261 K:
Fe | Fe2+ (0.903 M) || Cd2+ (0.991 M) | Cd
Given EoCd2+→Cd = -0.403 V, EoFe2+→Fe = -0.441 V. Calculate the cell potential after the reaction has operated long enough for the Fe2+ to have changed by 0.373 mol/L
In: Chemistry
Assume two neighbors who live next to a pond. Both neighbors get together to determine how each of them value a large deck overseeing the pond. After some economic analysis, they arrive at the following demand estimates: Qa = 160 − 20Pa , Qb = 60 − 5Pb where Q is the size of the deck to be built and P is the price of inputs and labor.
a) Based on these estimates, determine the market demand (assuming these are the only two households living next to the pond) for this public good, the deck overlooking the pond. Draw three graphs on the top of each other -first graph for A’s demand, a second graph for B’s demand, and the third graph for the market demand.
b) Explain the shape of the demand curve. Determine the willingness to pay when the size of the pond is 60 square feet.
c) If the market supply for pond decks were P= 6 + 0.15Q, what would be the optimal provision of this public good, that is what would the size of the pond?
d) Which neighbor is more likely to build the pond? Explain your answer.
In: Economics
on January 2nd 2016 the Jackson company purchased equipment to be used in its manufacturing process the equipment has an estimated life of 8 years and an estimated residual value of $30,625 expenditures made to acquire the assets were as follows
purchase price $154,000
Freight charges $2,000
installation charges $4,000
Jackson's policy is to use the double declining balance method of depreciation in the early years of the equipment's life and then switch to straight line halfway through the equipments life.
1. calculate depreciation for each year of the assets eight-year life
2. discuss the accounting treatment of the depreciation on the equipment
In: Accounting
A certain symmetric encrption system El uses the following secret key (KI) for confidential communication between A and B FEA01FAA3459012D (hex) A decides to deliver this secret key (K1) to B by transmitting it over the same insecure channel using a second encryption scheme E2 a- What method of encryption would you suggest for E2? b- Based on your suggestion, what would be the size in bits of the key (K2) used in encryption system E2? c- If a system of computers has the ability to try 64 keys every 100 microseconds in an effort to decipher the message encrypted by E1 by brute force, how long (on average) would it take to break the code? d- Is El computationally secure?
In: Computer Science
System Analysis project 4: can you answer the 4
questions at the task section, thank you.
Personal Trainer, Inc. owns and operates fitness centers in a dozen
Midwestern cities. The centers have done well, and the company is
planning an international expansion by opening a new “supercenter”
in the Toronto area. Personal Trainer’s president, Cassia Umi,
hired an IT consultant, Susan Park, to help develop an information
system for the new facility. During the project, Susan will work
closely with Gray Lewis, who will manage the new operation.
Background During requirements modeling for the new system, Susan
Park met with fitness center managers at several Personal Trainer
locations. She conducted a series of interviews, reviewed company
records, observed business operations, analyzed the BumbleBee
accounting software, and studied a sample of sales and billing
transactions. Susan’s objective was to develop a list of system
requirements for the proposed system.
Fact-Finding Summary
• A typical center has 300–500 members, with two membership levels: full and limited. Full members have access to all activities. Limited members are restricted to activities they have selected, but they can participate in other activities by paying a usage fee. All members have charge privileges. Charges for merchandise and services are recorded on a charge slip, which is signed by the member. • At the end of each day, cash sales and charges are entered into the BumbleBee accounting software, which runs on a computer workstation at each location. Daily cash receipts are deposited in a local bank and credited to the corporate Personal Trainer account. The BumbleBee program produces a daily activity report with a listing of all sales transactions. • At the end of the month, the local manager uses BumbleBee to transmit an accounts receivable summary to the Personal Trainer headquarters in Chicago, where member statements are prepared and mailed. Members mail their payments to the Personal Trainer headquarters, where the payment is applied to the member account. • The BumbleBee program stores basic member information, but does not include information about member preferences, activities, and history. • Currently, the BumbleBee program produces one local report (the daily activity report) and three reports that are prepared at the headquarters location: a monthly member sales report, an exception report for inactive members and late payers, and a quarterly profitand-loss report that shows a breakdown of revenue and costs for each separate activity. During the interviews, Susan received a number of “wish list” comments from managers and staff members. For example, managers want more analytical features so they can spot trends and launch special promotions and temporary discounts. Managers also want better information about the profitability of specific business activities at their centers, instead of bottom-line totals. Several managers want to offer computerized activity and wellness logs, fitness coaching for seniors, and various social networking options, including e-mail communications, fitness blogs, Facebook, and Twitter posts. Staff members want better ways to handle information about part-time instructors and trainers, and several people suggested using scannable ID cards to capture data
Tasks
1. Draw a DFD that shows how data will be stored, processed, and transformed in the TIMS system.
2. Draw an FDD that shows the Personal Trainer’s main functions. Also draw a use case diagram that represents the interaction between a user and the proposed TIMS system.
3. Using the information gathered during fact-finding, develop a requirements checklist that includes examples in each of the five main categories.
4. Gray is not familiar with the TCO concept. How should Susan explain it to him?
In: Computer Science
What is Ohm's law? Why Einstein didn't propose Laws of motion?
In: Physics
The cost of capital represents the weighted average cost of all sources of long-term financing to the firm, is normally the discount rate to use in analyzing an investment, is based on the valuation techniques from the previous chapter and is applied to bonds, preferred stock and common stock.
What does this mean?
In: Finance
1. The given mRNA sequence is transcribed from the gene below it.
5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’
3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’
5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’
Within the double-stranded DNA above:
a. Which strand ( top / bottom ) is the coding strand?
b. Circle the -10 promoter element.
c. Underline a single nucleotide indicating the transcription start site.
d. Circle the translation start and stop codons.
e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always some 5’ untranslated region encoded in the mRNA. Give the N and C ends of the protein.
In: Biology
When 0.601 g of biphenyl (C12H10) undergoes combustion in a bomb calorimeter, the temperature rises from 26.1 ∘C to 30.3 ∘C.
Find ΔErxn for the combustion of biphenyl in kJ/mol biphenyl. The heat capacity of the bomb calorimeter, determined in a separate experiment, is 5.86 kJ/∘C.
In: Chemistry
A block of copper, of unkown mass, initially at 75.7 celcius is immersed in a beaker containing 125.5 g of water at 20.7 celcius. At thermal equilibrium, the final temperature is 24.2 celcius. What is the mass of the copper if the specific heat capacities of water is 4.18 J/(gC) and copper is 0.385 J/(gC))
In: Chemistry
For the following reaction between Mohr\'s salt (iron as FeSO4(NH4)2SO4
In: Chemistry