Name the three ionotropic glutamate receptors in the brain. For each, identify the ions that move to create the depolarizing effects. What effects does the drug NBQX have on these receptors and on behavior?
In: Biology
Many of the vitamins and minerals are considered to be both essential and toxic, why is this?
In: Biology
The non mutated Sequence:
Point Mutation:
Frameshift Insertion Mutation:
Frameshift Deletion Mutation:
In: Biology
Most people who are infected with the HTLV-1 virus are asymptomatic carriers. One specific subtype of HTLV-I occurs only in a sub-population of the Japanese population and among the native peoples of the Andes mountain area of northern Chile. The researchers are looking for the presence of HTLV-1 DNA in the bone marrow cells of well-preserved Andean mummies. The presence of HTLV-1 DNA in the mummies, of the same subtype observed in Japan, would indicate that some of the first people to migrate to the New World came from Japan.
You identified the type of genome possessed by HTLV-1 in your previous answer. Explain how/why HTLV-1 DNA might be found in the bone marrow of the mummies. Be thorough and specific in your response.
In: Biology
Briefly describe one way in which behavioral biology aids in the reintroduction of captive-bred animals to wild habitats
In: Biology
|
(3) The following is a list of loci from Drosophila melanogaster that have been mapped via linkage studies. The symbols for the loci have been shortened to one letter, and map distances have been rounded. Here are the map distances, in cM, for all pair-wise combinations of the 7 loci:
How many linkage groups are defined by these loci? Draw a map for each linkage group with the locus positions indicated. Include the distances between each neighbor. Example: y x z 4 8 Your map(s): |
In: Biology
This Question refers to the the following Urinalysis Results Chart.
Sample A tests positive for high levels of protein. When a urine sample tests positive for protein, kidney damage could be to blame. High levels of urinary protein can be found in the disease of either hypertension or diabetes, because both can cause kidney damage. However, other results can be used to distinguish between these diseases.
Based on the findings listed in Sample A below, conclude whether this patient suffers from hypertension, or suffers from diabetes. Write your answer in the space below.
| SAMPLE | |||||
| CHARACTERISTIC | Sample A | Sample B | Sample C | Sample D | Sample E |
| Color | light yellow | tinged red | cloudy | cloudy | dark amber |
| Odor | sweet | pungent | foul/fishy | none | none |
| Leukocytes present? | none | none | some | some | none |
| Ketones present? | yes | none | none | none | none |
| pH | slightly acidic | normal | slightly alkaline | slightly alkaline | normal |
| Glucose present? | yes - high | none | none | none | none |
| Protein present? | yes - high | none | none | yes - high | none |
In: Biology
Explain what occurs during depolarization and repolarization in the circulatory system?
In: Biology
An example of a mutualistic nutritional (dietary) symbiosis is that between:
Which pathogen enters via a parenteral route?
In: Biology
Are there similar disease’s that might get confused with this hyperthyriodism?
Compare how you would rule in or out the difference’s between the different diseases similar to this hyperthyriodism?
In: Biology
A researcher studies normal human fibroblast cells.
They can be maintained in culture but die off after about 30 cell
generations. Unexpectedly, a colony of cells continues to survive
and divide past 30 generations. Which scenario is most likely true
for these cells?
In: Biology
Diabetes mellitus occurs with hyposecretion of insulin or hypoactivity of insulin.
Define polyuria, polydipsia, and polyphagia.
Explain why these symptoms occur with diabetes mellitus.
In: Biology
Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below as the top strand in the 5’ to 3’ orientation.
1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt
61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc
121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa
181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga
241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg
301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga
361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta
421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg
481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga
541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga
601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat
661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg
721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt
781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac
841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt
901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga
961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca
1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg
1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt
1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac
1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt
1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag
1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca
Primers have been designed to amplify a specific portion (316 base pairs) of the wild-type gene sequence.
3CF gcaaaagagagagtttcttgctg
3CDR tgcaccatccatacttactttcac
Note: these are in 5’ to 3’ orientation
Question- Locate where the primers will adhere to the sequence and amplify this portion of the gene for identification in gel electrophoresis. Highlight the matching 5’ to 3’ sequencing by changing it to boldface.
1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt
61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc
121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa
181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga
241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg
301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga
361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta
421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg
481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga
541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga
601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat
661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg
721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt
781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac
841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt
901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga
961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca
1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg
1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt
1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac
1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt
1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag
1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca
In: Biology
Paracrine signaling mechanisms and transcription factors have been seen to play key roles in several different developmental processes throughout both the invertebrate and vertebrate animal kingdom.
a. Pick ONE signaling mechanism. Using two different developmental stages/processes, within ONE organism, and describe HOW it is used in each.
Pick ONE signaling mechanism. Using two different model organisms studied this semester, Compare and Contrast how that ONE mechanism is used at the SAME developmental stage/process in each.
In: Biology