14) Using the following findings of volume flow and osmolarity throughout a nephron, describe andfully explain the processes occurring at each of the listed sites of the nephron, to generate the listed flow and osmolarity.

Blood flow into the glomerulus is at 280 mOsM, of which the albumin (large proteins) constitutes 90 mOsM. FLUID OSMOLARITY FLOW VOLUME Glomerular Filtrate 300 mOsM 7.5 L per hour End of Proximal Tubule 300 mOsM 2.5 L per hour End of Descending Loop 1200 mOsM 0.625 L per hour End of Ascending Loop 100 mOsM 0.625 L per hour Distal Tubule through End of Collecting Duct 100 mOsM 0.25 L per hour GLOMERULUS -PROXIMAL TUBULE -DESCENDING LOOP -ASCENDING LOOP -DISTAL NEPHRON

15) Describe the expected immune response to the following scenario: enveloped virus particles enter through the respiratory system, infecting epithelial cells of the upper airways. As the bronchial epithelial cells die and release new viral particles, these enter lymphatic capillaries and travel to the lymph nodes in the neck

. (16) A vaccine for Coronavirus is likely to take a longer time than imagined, because the most obvious target of the vaccine should be the external spike protein on the envelope of this enveloped virus. The cellular attachment protein on epithelial cells, which the virus binds to for entry into the epithelial cell, is known to be ACE2, a receptor enzyme. Explain why the production of a vaccine targeting the coronavirus spike protein (S1), is not likely to be successful.

Question 6:

(1 mark)

An mRNA has the following codon:

5? GCA 3?.

What tRNA anticodon will bind to this codon?

The tRNA anticodon 5'  3' will bind to the mRNA codon 5' GCA 3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

1 points   

QUESTION 7

Question 7:

(1 mark)

A tRNA anticodon has the following sequence:

3' CUA 5'.

What amino acid does it carry?

The amino acid carried on a tRNA with the anticodon 3' CUA 5' is .

**Hint: You will need to consult the genetic code to answer this question. And watch your 5' to 3' direction.**

1 points   

QUESTION 8

Questions 8 to 13 are based on the following information.

Question 8:

The top strand of the following segment of DNA serves as the template strand:

3’ TACACCTTGGCGACGACT 5’

5’ ATGTGGAACCGCTGCTGA 3’

We will refer to this segment of DNA as the original (or unmutated) sequence.

Please answer the following questions:

(a) What is the mRNA sequence?

The mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

4 points   

QUESTION 9

Questions 9 to 13 are in reference to the DNA sequence shown in Question 8.

Question 9:

The original (unmutated) DNA sequence (shown above in Question 8) has been mutated to the following (this represents the template strand):

3’ TACATCTTGGCGACGACT 5’.

We will refer to this sequence as mutation #1.

Please note that for simplicity only the template strand for this mutated segment of DNA is shown.

Answer the following questions:

(a) What is the complete mRNA sequence for the mutated segment mutation #1?

The mutated mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

Define and give examples of convergent evolution

• Use a phylogenetic tree to summarize the evolutionary relationships among vertebrates

• Identify the main characteristics of each major vertebrate group (fish, amphibians, reptiles, birds, mammals)

• List the four types of tissues that occur in all vertebrate bodies and summarize their functions

1.) Which bacteria grew in the widest range of temperatures?

a.) P.fluorescens

b.) B. gloibporus

c.) B. stearothermophilus

d.) E. oli

2.) Which of the following bacteria gre best at the lowest osmotic pressure?

a.) S.ruber

b.) E. coli

c.) S. aureus

d.) V. costicola

3.) Which statement explains what aerobes use oxygen to do?

a.) to insulate themselves in anaerobic enviroments

b.) to prevent free radicals from reacting with DNA and other vital molecules

c.) to provide the alcohol group added to organic compounds in fermentation

d.) to oxidize organic compounds for the release of energy and/or as a terminal electron acceptor

Come up with the best Genus species of bacteria for each case. Given the following description:

Gram (+) cocci arranged in grape-like clusters

Non-spore former

Produced the enzyme catalase

Beta-Hemolytic

Produces the enzyme coagulase

Acid from mannitol

Yellow-gold colony pigment

Novobiocin sensitive

Options are Micrococcus, Planococcus, or Staphyloccus.

Explain the morphology, physiology and virulence factors.

Explain how protists fit into the phylogenetic tree of life

Identify the basic structures common to fungi, including: cell walls, hyphae/mycelium, and spores

Give an overview of the haploid/diploid life cycle of fungi and compare to the haploid/diploid cycle in animals

Describe the following symbiotic relationships of fungi and their ecological impacts: • Mycorrhizae • Lichens • Parasitic/pathogenic fungi

8. Define the term mycosis, and differentiate between systemic mycosis, subcutaneous mycosis, and superficial mycosis. If a person contracted a fungal disease that was caused by the group of fungi known as dermatophytes, what type of mycosis would this be? Why is this group of fungi able to cause this type of infection and how it is usually transmitted?
   

Tristan is a lively little boy who attends daily day-care. He has severe allergies so his parents have not allo to receive the usual childhood vaccination series for fear of a severe reaction. For the last few days he has ha & swollen throat, fever & won't eat. Inside his mouth a greyish slime, a type of membrane, can be seen at the his throat . His parents take him to Urgent Care . 1. What's your disease diagnosis ? 2. What treatment should be used to combat the effects of toxemia? 3. Why would this tx be a particular challenge for this little boy?

Describe how graded potentials are regulated and how they regulate action potential firing. In your answer, specifically identify where on a neuron each event occurs.

1. Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).

            Remember: Analyze in the 5’à 3’ direction

1. HindII --- 5' GTC ↓GAC 3'

5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3'

3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5'

Number of pieces of DNA _______

2. EcoRI --- 5' G ↓AATTC 3'

5' ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'

3' TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'

Number of pieces of DNA _______

3. HaeIII --- 5' CC ↓ GG 3'

5' ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3'

3' TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5'

Number of pieces of DNA _______

4. BamI --- 5' CCTAG ↓G 3'

5' ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3'

3' TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5'

Number of pieces of DNA _______

5. HindII --- 5' GTC ↓- GAC 3' and HaeIII --- 5' CC ↓ GG 3'

5' ACGGTCGACACGTATTATTAGTCGACTCCGCCGCCGCCGGTCATCA 3'

3' TGCCAGCTGTGCATAATAATCAGCTGAGGCGGCGGCGGCCAGTAGT 5'

Number of pieces of DNA _______

6.   HindII --- 5' GTC ↓ GAC 3', HaeIII --- 5' CC ↓ GG 3' and BamI --- 5' CCTAG ↓ G 3'

5' ACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCG CCCCTAGGGTCATCA 3'

3' TGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5'

Number of pieces of DNA _______

Uncontrolled cell division is a feature of cancer which can result from chromosomal translocations. Discuss with examples. 2 pages min please.

Name five common characteristics of protein-coding genes and the regions surrounding them.

Why is prediction of eukaryotic genes more complex than prediction of prokaryotic genes?

2.    List and explain one beneficial effect and one detrimental effect of bacteria.

What is the effect of point mutations in DNA on proteins?

How does this relate to phenotypic variation, genotypes and alleles?

Answer in 4-5 sentences giving a REAL example of such a mutation.  

What are strengths and weaknesses of each of the major types of epidemiologic study?

-Randomized controlled trial

– Cohort

– Case-control