liver cirrohsis

Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below as the top strand in the 5’ to 3’ orientation.

        1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt

       61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc

      121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa

      181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga

      241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg

      301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga

      361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta

      421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg

      481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga

      541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga

      601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat

      661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg

      721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt

      781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac

      841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt

      901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga

      961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca

     1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg

     1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt

     1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac

     1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt

     1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag

     1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca

• Primers have been designed to amplify a specific portion (316 base pairs) of the wild-type gene sequence.

3CF gcaaaagagagagtttcttgctg

3CDR tgcaccatccatacttactttcac

Note: these are in 5’ to 3’ orientation

Question- Locate where the primers will adhere to the sequence and amplify this portion of the gene for identification in gel electrophoresis. Highlight the matching 5’ to 3’ sequencing by changing it to boldface.

1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt

       61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc

      121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa

      181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga

      241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg

      301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga

      361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta

      421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg agaattcagt tgattgaccg

      481 tgtttcttcc tttttgcagg gctcagattg ttggatggcc accagttaga tcttacagga

      541 agaacaacat tcagagtaag aagaatgaat ctgagcatga gggtcaagga atctatgtga

      601 aagtaagtat ggatggtgca ccatacttga ggaaaataga tctgagttgt tacaaaggat

      661 actcagagtt gcttaaagct ttagaagtga tgttcaaatt ctctgtggga gagtactttg

      721 agagagatgg atataaaggt tcagactttg tgcctactta tgaagacaaa gatggtgatt

      781 ggatgctcat tggtgatgtt ccatgggagt aagtcttctt tcatatacct gtctgaaaac

      841 aatttccaca aaatcaaaaa tcagaaacaa caattttgta agtgttctta tgggttctgt

      901 ttgttgttgc aggatgttca tatgtacgtg caagagacta aggatcatga aaggatcaga

      961 agccaaaggt ttaggctgtg gtgtatgaga tatatcttca agaaatctaa cagagacaca

     1021 aaagaacttg aagaaaaata gagtttcttt tggttcagag aaatctctgt ctgtgcttgg

     1081 gttgtcgggt ttctcgggca agatctatgt tcattggatt gaatccaatt catagccttt

     1141 atttacctca tcggtaaaat tcaaatgtaa acatgcttaa tggtcttaag catatgaaac

     1201 tggaacctaa ttacattttg tttcagaaac agggcaaaag gttgtcctta aatctttggt

     1261 tatgtgtatt acattaatta aagtgttatg aagattgaag agttgttttt atatttgtag

     1321 caattctgtt ttgcgttctc attgatcaaa gagattttca agca

Paracrine signaling mechanisms and transcription factors have been seen to play key roles in several different developmental processes throughout both the invertebrate and vertebrate animal kingdom.

a. Pick ONE signaling mechanism. Using two different developmental stages/processes, within ONE organism, and describe HOW it is used in each.

Pick ONE signaling mechanism. Using two different model organisms studied this semester, Compare and Contrast how that ONE mechanism is used at the SAME developmental stage/process in each.

Developmental biology THEMES including concentration gradients, time, location/induction, inhibition of an inhibition, negative and positive feedback loops, etc. just to name a few. Pick ONE themes and using three different developmental stages/processes provide three detailed examples of this ONE theme (if possible to do these three stages/processes in one model organism please do so, but if choose to use more than one organism for your examples that is fine).

MULTIPLE CHOICE

1. Glutamate plays a specific functional role in

a. synaptic plasticity.

b. anxiety reduction.

c. the action of alcohol.

d. seizure suppression.

2. The most abundant inhibitory neurotransmitter in the brain is

a. Acetylcholine

b. Dopamine

c. Glutamate

d. GABA

Developmental Biology has made substantial contributions to the field of Evolutionary Biology, providing tools that allow us to mechanistically study Darwin’s concept of “Descent with Modification”. This combination of Developmental and Evolutionary Biology has become its own discipline, Evo-Devo. The phenomena of heterotopy, heterochrony, and heterometry can combine in a variety of ways to bring about generational variation in a species that can, in conjunction with natural selection, result in evolutionary changes. “Darwin’s Finches” is an example of this. Provide and Evo-Devo description of how an animal such as a hippopotamus might have given rise, over many generations, to animals like whales and dolphins.

A man is heterozygous for achondroplasia for which the autosomal dominant A allele confers extremely short stature. His wife's genotype is aa and she is normal height. They have five children together. What is the probability that any two of their five children will have the short stature phenotype, in any birth order?

define the following terminology:

(a) Basal forebrain

(b) Nicotinic acetylcholine receptor (nAChR)

(c) Muscarinic acetylcholine receptors (mAChR)

Why do common folding patterns appear in proteins that exhibit very different primary structures?

The carbonyl and amino groups of the amino-acid residues at the N- and C-termini of proteins form regular patterns of hydrogen bonds that define α-helix and β-sheet shapes.

The carbonyl and amide groups of the polypeptide backbone form regular patterns of hydrogen bonds that define α-helix and β-sheet shapes.

The carbonyl and amino groups of glutamate and glutamine, respectively, form regular patterns of ionic bonds that define α-helix and β-sheet shapes.

The carboxyl and amino groups of the amino-acid residues at the N-and C-termini of proteins form regular patterns of ionic bonds that define α-helix and β-sheet shapes.

The carbonyl and amide groups of the amino-acid sidechains form regular patterns of hydrogen bonds that define α-helix and β-sheet shapes.

How is botulinum toxin being used today in therapeutic and cosmetic settings?

Compare and contrast the reproduction, brooding strategies and life cycle of anurans (frogs and toads) and urodeles (newts and salamanders).

PLEASE ANSWERS 1-3 QUESTIONS AND ILL LIKE AND COMMENT

1. Which of the following biomes is NOT matched correctly with a characteristic of that biome?

Select one:

a. temperate evergreen forest – dominated by conifer trees

b. tropical rainforest - hot summers and cold winters

c. temperate grassland - adapted to periodic fire

d. tundra - permafrost

e. desert - little or no rainfall

2.

Deep sea hydrothermal vent communities:

Select one:

a. use bioluminescence to generate food.

b. contain only bacteria and other microorganisms.

c. use energy from photosynthesis in the photic zone.

d. use energy produced by chemoautotrophs that oxidize sulfur.

3.

At what latitudes are most of the world’s major deserts and associated arid areas located?

Select one:

a. 0° N and S

b. 15° N and S

c. 30° N and S

d. 60° N and S

e. 90° N and S

MAKE A 6 POWER POINT SLIDES FOR THIS AND EXPLAINING:

What is the classification and history Antlion larva?

What is the significance of Antlion larva and how does it relate to science, environment, or health?

Is it pathogenic? If so, what does it cause and what is the treatment? Who does it affect and What part of the world is it found in?

Is there anything about Antlion larva that makes it unique and interesting?

REFERENCE

A newly identified frog mutant, persistent tail (retains the tail through metamorphosis), is hypothesized to be autosomal dominant. The experimenter started with homozygous wild type virgin females and homozygous persistent tail males. The data from the F2 generation was 83 wild type males, 111 wild type females, 141 persistent tail males and 211 persistent tail females. Does this data support or reject the hypothesis? Use chi-square to prove your position.