Early in an infection, the body produces a variety of "acute phase proteins" to ramp up an immune response. What sort of benefits do these acute phase proteins provide and what sort of effect would an inability to induce the production of these proteins have on an individual?

Compare your crayfish with one of the opposite gender.

What body region or segment are the walking legs attached to? What about the swimmerets?

How does the shape of each appendage type fit its particular function?

1. Chelipeds:
2. Walking legs:
3. Swimmerets:

3) Describe the purposes of the principle process involved in treatment of waste water .

4. Explain the difference between a positive and negative hormonal feedback loop. How is the testis (i.e. testosterone) regulated ? Explain why giving exogenous testosterone has little effect on serum levels but dramatic lowering of testicular testosterone concentrations. (10 points)

Describe five different mechanisms or means that one could pursue to prevent or reduce micronutrient deficiencies and provide an example for each that has been applied to improve the dietary quality of food for an at risk population.

Why is it important to have sterile workspaces and equipment when performing cell transformations and culturing?

1. What is microevolution?

2. Explain through the process of microevolution how natural selection produces adaptations while other evolutionary forces (specifically genetic drift, migration/gene flow, and non-random mating) may produce random evolutionary changes within populations.

3. Explain why evolution is a population-level phenomenon. Why does population size affect some evolutionary mechanisms, but not other(s)?

Will give a thumbs up for a good answer. Please help me!

Bill has come to you for genetic counseling.  He is concerned that he and his sister (Alice) are at risk for Huntington disease. Bill and Alice are too young to show symptoms.  Their grandmother, (Mary) had Huntington disease.  Her three children, Shirley, Tom, and Ed so far show no symptoms.  Shirley is the oldest (45 years old) and is Bill and Alice’s mother. A study by Adams (American Journal of Human Genetics 43;695 – 704, 1988) indicates that 68% of individuals heterozygous for the Huntington allele show symptoms by age 45.   

a. Draw a pedigree of this family.

b. What is the probability that Bill is heterozygous for Huntington disease?

c. What test(s) would you recommend for Bill and Alice to determine if they are heterozygous?

d. Explain why you recommend this test, what results it can give, and how these results can answer Bill’s question.

1)Explain the most and least effective uses of a viable plate count.

2)Determine if complement is part of innate immunity or acquired immunity or both and defend your decision.

3)Explain how the results of a diagnostic test could be completely reversed if the test is given to the same patient several months/years apart.

The sirtuins are a class of NAD-dependent deacetylases that are thought to play a role in the cellular response to nutritional status. Some sirtuins are involved in remodeling chromatin structure. A) How would you expect deacetylation of histones to affect the transcriptional activity of genes? B) Sirtuin 3 (Sirt3) deacetylates a specific lysine in the active site of acetyl-CoA synthetase, activating the enzyme. Why would this particular deacetylation reflect nutritional status? Remember, acetyl-CoA synthetase catalyzes the reaction: ATP + acetate + CoA <=> AMP + PPi + acetyl-CoA

Describe the sexual reproduction cycle in fungi (a general process, not for a specific type of fungi). Is the fungal sexual life cycle a type of alternation of generations seen in plants and some algae? Explain.

1. You are studying a particular type of lung cancer, small-cell lung carcinoma. You are interested on driver mutations of this cancer, that is mutations that provide strong selection advantage and thus have strong potential in initiating tumorigenesis. You have access to primary tumor biopsies from patients, and healthy surrounding tissue: how you can best use these tissue samples to identify mutations underlying this particular type of lung cancer?

2. The mutation you isolated has not been characterized before; how can the crystal structure of the protein bound on DNA help you understand how the mutation affects the function of the protein? What are some common mutations of the p53 protein that drive cancers?

3. You believe DNA binding is affected by the identified mutation, and your next goal is to characterize the functional perturbations of the mutant p53. a. Describe an in vitro approach to study the function of the mutant protein. b. Describe an experimental approach using cultured cells that can illuminate the altered function of the mutant protein

4. You find in #3 that the expression levels of certain miRNAs are changed as a result of the p53 mutation. a. What experimental approach can reveal how altered miRNA levels change Ago/miRNA targeting of mRNAs at the transcriptome wide level? b. What experimental approach can quantify altered translation levels for the mRNAs identified in a)?

Knockout mice are created by incubating embryonic stem (ES) cells with a DNA construct that contains a portion of the gene with a disrupted exon. The exon is disrupted by inserting a gene for neomycin resistance (neo^r) into the exon. When the DNA construct carrying the disrupted exon is taken up by an ES cell, a knockout allele results when the added DNA construct

(a)        replicates as an independent DNA molecule in the ES cell and is maintained in all cells derived from it.

(b)       undergoes homologous recombination with the wild type allele of the gene in the ES cell.

(c)        inserts randomly in the genome of the ES cell.

(d)       is processed in the ES cell such that the neo^r gene is excised and pasted at random sites in the genome of the ES cell.

Depending on the vector used for gene therapy, the therapeutic gene can integrate into the chromosome or it can stay as an extrachromosomal piece of DNA (episome). Some long-lived cells (for example, neurons, myocytes, hepatocytes) can have stable long-term expression of the therapeutic gene without integration of the introduced gene into the host genome. Which vectors will be most suitable for introduction of a gene into long-lived cells, where the introduced gene does not integrate into the host genome?

(a) Vectors derived from retroviruses

(b)       Vectors derived from Adeno-associated viruses (AAVs)

(c)        Vectors derived from plant viruses

(d)       Vectors derived from bacterial viruses

For genome editing of a crop plant by CRISPR-Cas9, you have designed a sgRNA (single guide RNA) that contains a sequence that recognizes the target sequence in the genome of the plant, and a region that binds to the Cas9 protein. Given the following target sequence in the genome, the sequence of the sgRNA that recognizes the target sequence is ______________________________. Binding of the sgRNA-Cas9 complex to the target site will lead to a ______________ (single or double)-stranded cut in the DNA. Fill in the blanks using the following choices.

3’-------------GATCGGATCGATGGAACAGA-------------5’

     5’-------------CTAGCCTAGCTACCTTGTCT-------------3’

(a)        3’ – CUAGCCUAGCUACCUUGUCU – 5’; single

(b)       3’ – CUAGCCUAGCUACCUUGUCU – 5’; double

(c)        5’ – CUAGCCUAGCUACCUUGUCU – 3’; single

(d)       5’ – CUAGCCUAGCUACCUUGUCU – 3’; double

What is the number of ATP and ATP equivalents that can be produced via oxidative phosphorylation per cycle of the Citric Acid Cycle (CAC), starting from pyruvate? B) What is the number of ATP and ATP equivalents that can potentially be produced if Complex I of the Electron Transport System (ETS) is inhibited? C) If Complex II of the ETS is inhibited? D) If Complex III of the ETS is inhibited? E) If Complex IV of the ETS is inhibited?